CLK3 Rabbit Polyclonal Antibody

CLK3 Rabbit Polyclonal Antibody

CLK3 Polyclonal Antibody

ABP58190-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein

CLK3 Polyclonal Antibody

ABP58190-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein

CLK3 Polyclonal Antibody

ABP58190-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CLK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLK3 from Human, Mouse, Rat. This CLK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLK3 protein

CLK3 Antibody

ABD2662 100 ug
EUR 438

CLK3 Antibody

44883-100ul 100ul
EUR 252

CLK3 Antibody

44883-50ul 50ul
EUR 187

CLK3 Antibody

DF2662 200ul
EUR 304
Description: CLK3 antibody detects endogenous levels of total CLK3.

Dual Specificity Protein Kinase CLK3 (CLK3) Antibody

abx145545-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dual Specificity Protein Kinase CLK3 (CLK3) Antibody

20-abx147511
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dual Specificity Protein Kinase CLK3 (Clk3) Antibody

abx028442-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Protein Kinase CLK3 (Clk3) Antibody

abx028442-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Clk3/ Rat Clk3 ELISA Kit

ELI-10192r 96 Tests
EUR 886

CLK3 Conjugated Antibody

C44883 100ul
EUR 397

Anti-CLK3 antibody

STJ191969 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CLK3

CLK3 siRNA

20-abx901115
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLK3 siRNA

20-abx912091
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLK3 siRNA

20-abx912092
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CLK3

YF-PA10988 50 ul
EUR 363
Description: Mouse polyclonal to CLK3

anti-CLK3

YF-PA10989 50 ug
EUR 363
Description: Mouse polyclonal to CLK3

anti-CLK3

YF-PA23473 50 ul
EUR 334
Description: Mouse polyclonal to CLK3

CLK3 cloning plasmid

CSB-CL005560HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1473
  • Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
  • Show more
Description: A cloning plasmid for the CLK3 gene.

CLK3 cloning plasmid

CSB-CL005560HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1473
  • Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
  • Show more
Description: A cloning plasmid for the CLK3 gene.

CLK3 cloning plasmid

CSB-CL005560HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1404
  • Sequence: atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccaga
  • Show more
Description: A cloning plasmid for the CLK3 gene.

CLK3 Blocking Peptide

DF2662-BP 1mg
EUR 195

Anti-CLK3 (3C11)

YF-MA12477 200 ul
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (7D6)

YF-MA12478 200 ul
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (1H2)

YF-MA10170 100 ug
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (5B2)

YF-MA10171 100 ug
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (1F10)

YF-MA10172 100 ug
EUR 363
Description: Mouse monoclonal to CLK3

Anti-CLK3 (7D6)

YF-MA10173 50 ug
EUR 363
Description: Mouse monoclonal to CLK3

Bovine Dual specificity protein kinase CLK3, CLK3 ELISA KIT

ELI-10191b 96 Tests
EUR 928

Human Dual specificity protein kinase CLK3, CLK3 ELISA KIT

ELI-33821h 96 Tests
EUR 824

Mouse Dual specificity protein kinase CLK3, Clk3 ELISA KIT

ELI-46810m 96 Tests
EUR 865

Human Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit

abx384721-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit

abx388886-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Dual Specificity Protein Kinase CLK3 (CLK3) ELISA Kit

abx391137-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Clk3 ELISA Kit| Rat Dual specificity protein kinase CLK3 ELISA

EF018490 96 Tests
EUR 689

Clk3 ELISA Kit| Mouse Dual specificity protein kinase CLK3 ELIS

EF014511 96 Tests
EUR 689

CLK3 ELISA Kit| Bovine Dual specificity protein kinase CLK3 ELI

EF011240 96 Tests
EUR 689

Mouse CLK3 shRNA Plasmid

20-abx979540
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CLK3 shRNA Plasmid

20-abx987732
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CLK3 ELISA KIT|Human

EF004772 96 Tests
EUR 689

Human CLK3 shRNA Plasmid

20-abx950856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-CLK3 Plasmid

PVT16300 2 ug
EUR 325

Monoclonal CLK3 Antibody (monoclonal) (M04), Clone: 5B2

AMM03396G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5B2. This antibody is applicable in WB, IHC and IF

Monoclonal CLK3 Antibody (monoclonal) (M05), Clone: 1F10

AMM03397G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1F10. This antibody is applicable in WB, IHC and IF

Monoclonal CLK3 Antibody (monoclonal) (M07), Clone: 7D6

AMM03398G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human CLK3 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 7D6. This antibody is applicable in WB, IHC and IF

CLK3 ORF Vector (Human) (pORF)

ORF002456 1.0 ug DNA
EUR 95

CLK3 ORF Vector (Human) (pORF)

ORF002457 1.0 ug DNA
EUR 95

CLK3 ORF Vector (Human) (pORF)

ORF002458 1.0 ug DNA
EUR 95

Clk3 ORF Vector (Rat) (pORF)

ORF065132 1.0 ug DNA
EUR 506

h CLK3 inducible lentiviral particles

LVP091 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, CLK3, is fully sequence verified and matched to NCBI accession ID: NM_003992.4

Clk3 ORF Vector (Mouse) (pORF)

ORF041580 1.0 ug DNA
EUR 506

CLK3 sgRNA CRISPR Lentivector set (Human)

K0466101 3 x 1.0 ug
EUR 339

Clk3 sgRNA CRISPR Lentivector set (Mouse)

K4962601 3 x 1.0 ug
EUR 339

Clk3 sgRNA CRISPR Lentivector set (Rat)

K6984301 3 x 1.0 ug
EUR 339

CLK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0466102 1.0 ug DNA
EUR 154

CLK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0466103 1.0 ug DNA
EUR 154

CLK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0466104 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4962602 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4962603 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4962604 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6984302 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6984303 1.0 ug DNA
EUR 154

Clk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6984304 1.0 ug DNA
EUR 154

CLK3 Protein Vector (Mouse) (pPB-C-His)

PV166318 500 ng
EUR 603

CLK3 Protein Vector (Mouse) (pPB-N-His)

PV166319 500 ng
EUR 603

CLK3 Protein Vector (Mouse) (pPM-C-HA)

PV166320 500 ng
EUR 603

CLK3 Rabbit Polyclonal Antibody