CNBP Rabbit Polyclonal Antibody

CNBP Rabbit Polyclonal Antibody

CNBP Polyclonal Antibody

ABP58200-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNBP protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of CNBP from Human, Mouse, Rat. This CNBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNBP protein at amino acid sequence of 60-140

CNBP Polyclonal Antibody

A50129 100 µg
EUR 570.55
Description: reagents widely cited

CNBP Rabbit pAb

A15110-100ul 100 ul
EUR 308

CNBP Rabbit pAb

A15110-200ul 200 ul
EUR 459

CNBP Rabbit pAb

A15110-20ul 20 ul
EUR 183

CNBP Rabbit pAb

A15110-50ul 50 ul
EUR 223

CNBP Rabbit pAb

A9034-100ul 100 ul
EUR 308

CNBP Rabbit pAb

A9034-200ul 200 ul
EUR 459

CNBP Rabbit pAb

A9034-20ul 20 ul Ask for price

CNBP Rabbit pAb

A9034-50ul 50 ul Ask for price

CNBP Antibody

ABD10045 100 ug
EUR 438

CNBP Antibody

44477-100ul 100ul
EUR 252

CNBP Antibody

44477-50ul 50ul
EUR 187

CNBP antibody

10R-8684 50 ul
EUR 241
Description: Mouse monoclonal CNBP antibody

CNBP antibody

70R-16468 50 ul
EUR 435
Description: Rabbit polyclonal CNBP antibody

CNBP Antibody

DF10045 200ul
EUR 304
Description: CNBP Antibody detects endogenous levels of total CNBP.

CNBP Antibody

1-CSB-PA005637GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

CNBP Antibody

1-CSB-PA005637HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CNBP Polyclonal Antibody, HRP Conjugated

A50130 100 µg
EUR 570.55
Description: Ask the seller for details

CNBP Polyclonal Antibody, FITC Conjugated

A50131 100 µg
EUR 570.55
Description: The best epigenetics products

CNBP Polyclonal Antibody, Biotin Conjugated

A50132 100 µg
EUR 570.55
Description: kits suitable for this type of research

CNBP Conjugated Antibody

C44477 100ul
EUR 397

anti- CNBP antibody

FNab01793 100µg
EUR 548.75
  • Immunogen: CCHC-type zinc finger, nucleic acid binding protein
  • Uniprot ID: P62633
  • Gene ID: 7555
  • Research Area: Metabolism
Description: Antibody raised against CNBP

Anti-CNBP antibody

PAab01793 100 ug
EUR 386

Anti-CNBP antibody

STJ111535 100 µl
EUR 277
Description: This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CNBP antibody

STJ117304 100 µl
EUR 277
Description: This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CNBP antibody

STJ191728 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNBP

Cnbp/ Rat Cnbp ELISA Kit

ELI-51002r 96 Tests
EUR 886

CNBP siRNA

20-abx901139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNBP siRNA

20-abx912221
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNBP siRNA

20-abx912222
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-CNBP

PVT18396 2 ug
EUR 231

CNBP Antibody, HRP conjugated

1-CSB-PA005637HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CNBP Antibody, FITC conjugated

1-CSB-PA005637HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CNBP Antibody, Biotin conjugated

1-CSB-PA005637HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ZNF9 / CNBP antibody

STJ70911 100 µg
EUR 359

CNBP cloning plasmid

CSB-CL005637HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagatatttgttatcgctgtggtgagtctggtcatcttgccaagga
  • Show more
Description: A cloning plasmid for the CNBP gene.

CNBP cloning plasmid

CSB-CL005637HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagacatttgttatcgctgtggtgagtctggtcatcttgccaagga
  • Show more
Description: A cloning plasmid for the CNBP gene.

CNBP Blocking Peptide

DF10045-BP 1mg
EUR 195

Rat CNBP shRNA Plasmid

20-abx986278
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNBP ELISA KIT|Human

EF008750 96 Tests
EUR 689

Human CNBP shRNA Plasmid

20-abx955164
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNBP protein (His tag)

80R-2682 100 ug
EUR 322
Description: Purified recombinant CNBP protein (His tag)

Mouse CNBP shRNA Plasmid

20-abx969726
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNBP Recombinant Protein (Human)

RP007465 100 ug Ask for price

CNBP Recombinant Protein (Human)

RP007468 100 ug Ask for price

CNBP Recombinant Protein (Rat)

RP195554 100 ug Ask for price

CNBP Recombinant Protein (Mouse)

RP124937 100 ug Ask for price

CNBP Recombinant Protein (Mouse)

RP124940 100 ug Ask for price

CNBP Recombinant Protein (Mouse)

RP124943 100 ug Ask for price

Rabbit Cellular nucleic acid binding protein(CNBP) ELISA kit

E04C1841-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cellular nucleic acid binding protein(CNBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cellular nucleic acid binding protein(CNBP) ELISA kit

E04C1841-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cellular nucleic acid binding protein(CNBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cellular nucleic acid binding protein(CNBP) ELISA kit

E04C1841-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cellular nucleic acid binding protein(CNBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CNBP ORF Vector (Human) (pORF)

ORF002489 1.0 ug DNA
EUR 95

CNBP ORF Vector (Human) (pORF)

ORF002490 1.0 ug DNA
EUR 95

Cnbp ORF Vector (Rat) (pORF)

ORF065186 1.0 ug DNA
EUR 506

Cnbp ORF Vector (Mouse) (pORF)

ORF041647 1.0 ug DNA
EUR 506

Cnbp ORF Vector (Mouse) (pORF)

ORF041648 1.0 ug DNA
EUR 506

Cnbp ORF Vector (Mouse) (pORF)

ORF041649 1.0 ug DNA
EUR 506

CNBP sgRNA CRISPR Lentivector set (Human)

K0473901 3 x 1.0 ug
EUR 339

Cnbp sgRNA CRISPR Lentivector set (Mouse)

K4764501 3 x 1.0 ug
EUR 339

Cnbp sgRNA CRISPR Lentivector set (Rat)

K7092401 3 x 1.0 ug
EUR 339

CNBP sgRNA CRISPR Lentivector (Human) (Target 1)

K0473902 1.0 ug DNA
EUR 154

CNBP sgRNA CRISPR Lentivector (Human) (Target 2)

K0473903 1.0 ug DNA
EUR 154

CNBP sgRNA CRISPR Lentivector (Human) (Target 3)

K0473904 1.0 ug DNA
EUR 154

Cnbp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4764502 1.0 ug DNA
EUR 154

Cnbp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4764503 1.0 ug DNA
EUR 154

Cnbp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4764504 1.0 ug DNA
EUR 154

Human Cellular nucleic acid-binding protein (CNBP)

1-CSB-EP005637HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cellular nucleic acid-binding protein(CNBP) expressed in E.coli

Cnbp sgRNA CRISPR Lentivector (Rat) (Target 1)

K7092402 1.0 ug DNA
EUR 154

Cnbp sgRNA CRISPR Lentivector (Rat) (Target 2)

K7092403 1.0 ug DNA
EUR 154

Cnbp sgRNA CRISPR Lentivector (Rat) (Target 3)

K7092404 1.0 ug DNA
EUR 154

CNBP Protein Vector (Mouse) (pPB-C-His)

PV166586 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPB-N-His)

PV166587 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPM-C-HA)

PV166588 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPM-C-His)

PV166589 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPB-C-His)

PV166590 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPB-N-His)

PV166591 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPM-C-HA)

PV166592 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPM-C-His)

PV166593 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPB-C-His)

PV166594 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPB-N-His)

PV166595 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPM-C-HA)

PV166596 500 ng
EUR 603

CNBP Protein Vector (Mouse) (pPM-C-His)

PV166597 500 ng
EUR 603

CNBP Protein Vector (Human) (pPB-C-His)

PV009953 500 ng
EUR 329

CNBP Protein Vector (Human) (pPB-N-His)

PV009954 500 ng
EUR 329

CNBP Protein Vector (Human) (pPM-C-HA)

PV009955 500 ng
EUR 329

CNBP Protein Vector (Human) (pPM-C-His)

PV009956 500 ng
EUR 329

CNBP Protein Vector (Human) (pPB-C-His)

PV009957 500 ng
EUR 329

CNBP Protein Vector (Human) (pPB-N-His)

PV009958 500 ng
EUR 329

CNBP Protein Vector (Human) (pPM-C-HA)

PV009959 500 ng
EUR 329

CNBP Protein Vector (Human) (pPM-C-His)

PV009960 500 ng
EUR 329

CNBP Protein Vector (Rat) (pPB-C-His)

PV260742 500 ng
EUR 603

CNBP Protein Vector (Rat) (pPB-N-His)

PV260743 500 ng
EUR 603

CNBP Protein Vector (Rat) (pPM-C-HA)

PV260744 500 ng
EUR 603

CNBP Protein Vector (Rat) (pPM-C-His)

PV260745 500 ng
EUR 603

Cnbp 3'UTR Luciferase Stable Cell Line

TU202531 1.0 ml Ask for price

Cnbp 3'UTR GFP Stable Cell Line

TU154084 1.0 ml Ask for price

CNBP 3'UTR Luciferase Stable Cell Line

TU004671 1.0 ml
EUR 1521

Cnbp 3'UTR Luciferase Stable Cell Line

TU104084 1.0 ml Ask for price

CNBP 3'UTR GFP Stable Cell Line

TU054671 1.0 ml
EUR 1521

Cnbp 3'UTR GFP Stable Cell Line

TU252531 1.0 ml Ask for price

CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody

20-abx123518
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody

20-abx111452
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody

20-abx149425
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody

abx031491-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody

abx031491-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody

20-abx301160
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody

abx231793-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

CNBP Rabbit Polyclonal Antibody