CNBP Rabbit Polyclonal Antibody
CNBP Polyclonal Antibody |
ABP58200-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CNBP protein at amino acid sequence of 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of CNBP from Human, Mouse, Rat. This CNBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNBP protein at amino acid sequence of 60-140 |
CNBP Polyclonal Antibody |
A50129 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
CNBP Rabbit pAb |
A15110-100ul |
Abclonal |
100 ul |
EUR 308 |
CNBP Rabbit pAb |
A15110-200ul |
Abclonal |
200 ul |
EUR 459 |
CNBP Rabbit pAb |
A15110-20ul |
Abclonal |
20 ul |
EUR 183 |
CNBP Rabbit pAb |
A15110-50ul |
Abclonal |
50 ul |
EUR 223 |
CNBP Rabbit pAb |
A9034-100ul |
Abclonal |
100 ul |
EUR 308 |
CNBP Rabbit pAb |
A9034-200ul |
Abclonal |
200 ul |
EUR 459 |
CNBP Rabbit pAb |
A9034-20ul |
Abclonal |
20 ul |
Ask for price |
CNBP Rabbit pAb |
A9034-50ul |
Abclonal |
50 ul |
Ask for price |
CNBP Antibody |
44477-100ul |
SAB |
100ul |
EUR 252 |
CNBP Antibody |
44477-50ul |
SAB |
50ul |
EUR 187 |
CNBP antibody |
10R-8684 |
Fitzgerald |
50 ul |
EUR 241 |
Description: Mouse monoclonal CNBP antibody |
CNBP antibody |
70R-16468 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CNBP antibody |
CNBP Antibody |
DF10045 |
Affbiotech |
200ul |
EUR 304 |
Description: CNBP Antibody detects endogenous levels of total CNBP. |
CNBP Antibody |
1-CSB-PA005637GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
CNBP Antibody |
1-CSB-PA005637HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CNBP Polyclonal Antibody, HRP Conjugated |
A50130 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CNBP Polyclonal Antibody, FITC Conjugated |
A50131 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
CNBP Polyclonal Antibody, Biotin Conjugated |
A50132 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CNBP Conjugated Antibody |
C44477 |
SAB |
100ul |
EUR 397 |
anti- CNBP antibody |
FNab01793 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: CCHC-type zinc finger, nucleic acid binding protein
- Uniprot ID: P62633
- Gene ID: 7555
- Research Area: Metabolism
|
Description: Antibody raised against CNBP |
Anti-CNBP antibody |
STJ111535 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-CNBP antibody |
STJ117304 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-CNBP antibody |
STJ191728 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CNBP |
CNBP siRNA |
20-abx901139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNBP siRNA |
20-abx912221 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNBP siRNA |
20-abx912222 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNBP Antibody, HRP conjugated |
1-CSB-PA005637HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CNBP Antibody, FITC conjugated |
1-CSB-PA005637HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CNBP Antibody, Biotin conjugated |
1-CSB-PA005637HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNBP. Recognizes CNBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CNBP cloning plasmid |
CSB-CL005637HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 513
- Sequence: atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagatatttgttatcgctgtggtgagtctggtcatcttgccaagga
- Show more
|
Description: A cloning plasmid for the CNBP gene. |
CNBP cloning plasmid |
CSB-CL005637HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 513
- Sequence: atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagacatttgttatcgctgtggtgagtctggtcatcttgccaagga
- Show more
|
Description: A cloning plasmid for the CNBP gene. |
CNBP Blocking Peptide |
DF10045-BP |
Affbiotech |
1mg |
EUR 195 |
Rat CNBP shRNA Plasmid |
20-abx986278 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CNBP shRNA Plasmid |
20-abx955164 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CNBP protein (His tag) |
80R-2682 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Purified recombinant CNBP protein (His tag) |
Mouse CNBP shRNA Plasmid |
20-abx969726 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CNBP Recombinant Protein (Human) |
RP007465 |
ABM |
100 ug |
Ask for price |
CNBP Recombinant Protein (Human) |
RP007468 |
ABM |
100 ug |
Ask for price |
CNBP Recombinant Protein (Rat) |
RP195554 |
ABM |
100 ug |
Ask for price |
CNBP Recombinant Protein (Mouse) |
RP124937 |
ABM |
100 ug |
Ask for price |
CNBP Recombinant Protein (Mouse) |
RP124940 |
ABM |
100 ug |
Ask for price |
CNBP Recombinant Protein (Mouse) |
RP124943 |
ABM |
100 ug |
Ask for price |
Rabbit Cellular nucleic acid binding protein(CNBP) ELISA kit |
E04C1841-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cellular nucleic acid binding protein(CNBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cellular nucleic acid binding protein(CNBP) ELISA kit |
E04C1841-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cellular nucleic acid binding protein(CNBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cellular nucleic acid binding protein(CNBP) ELISA kit |
E04C1841-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cellular nucleic acid binding protein(CNBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CNBP ORF Vector (Human) (pORF) |
ORF002489 |
ABM |
1.0 ug DNA |
EUR 95 |
CNBP ORF Vector (Human) (pORF) |
ORF002490 |
ABM |
1.0 ug DNA |
EUR 95 |
Cnbp ORF Vector (Rat) (pORF) |
ORF065186 |
ABM |
1.0 ug DNA |
EUR 506 |
Cnbp ORF Vector (Mouse) (pORF) |
ORF041647 |
ABM |
1.0 ug DNA |
EUR 506 |
Cnbp ORF Vector (Mouse) (pORF) |
ORF041648 |
ABM |
1.0 ug DNA |
EUR 506 |
Cnbp ORF Vector (Mouse) (pORF) |
ORF041649 |
ABM |
1.0 ug DNA |
EUR 506 |
CNBP sgRNA CRISPR Lentivector set (Human) |
K0473901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cnbp sgRNA CRISPR Lentivector set (Mouse) |
K4764501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cnbp sgRNA CRISPR Lentivector set (Rat) |
K7092401 |
ABM |
3 x 1.0 ug |
EUR 339 |
CNBP sgRNA CRISPR Lentivector (Human) (Target 1) |
K0473902 |
ABM |
1.0 ug DNA |
EUR 154 |
CNBP sgRNA CRISPR Lentivector (Human) (Target 2) |
K0473903 |
ABM |
1.0 ug DNA |
EUR 154 |
CNBP sgRNA CRISPR Lentivector (Human) (Target 3) |
K0473904 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnbp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4764502 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnbp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4764503 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnbp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4764504 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Cellular nucleic acid-binding protein (CNBP) |
1-CSB-EP005637HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 34.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Cellular nucleic acid-binding protein(CNBP) expressed in E.coli |
Cnbp sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7092402 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnbp sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7092403 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnbp sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7092404 |
ABM |
1.0 ug DNA |
EUR 154 |
CNBP Protein Vector (Mouse) (pPB-C-His) |
PV166586 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPB-N-His) |
PV166587 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPM-C-HA) |
PV166588 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPM-C-His) |
PV166589 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPB-C-His) |
PV166590 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPB-N-His) |
PV166591 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPM-C-HA) |
PV166592 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPM-C-His) |
PV166593 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPB-C-His) |
PV166594 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPB-N-His) |
PV166595 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPM-C-HA) |
PV166596 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Mouse) (pPM-C-His) |
PV166597 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Human) (pPB-C-His) |
PV009953 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Human) (pPB-N-His) |
PV009954 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Human) (pPM-C-HA) |
PV009955 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Human) (pPM-C-His) |
PV009956 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Human) (pPB-C-His) |
PV009957 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Human) (pPB-N-His) |
PV009958 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Human) (pPM-C-HA) |
PV009959 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Human) (pPM-C-His) |
PV009960 |
ABM |
500 ng |
EUR 329 |
CNBP Protein Vector (Rat) (pPB-C-His) |
PV260742 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Rat) (pPB-N-His) |
PV260743 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Rat) (pPM-C-HA) |
PV260744 |
ABM |
500 ng |
EUR 603 |
CNBP Protein Vector (Rat) (pPM-C-His) |
PV260745 |
ABM |
500 ng |
EUR 603 |
Cnbp 3'UTR Luciferase Stable Cell Line |
TU202531 |
ABM |
1.0 ml |
Ask for price |
Cnbp 3'UTR GFP Stable Cell Line |
TU154084 |
ABM |
1.0 ml |
Ask for price |
CNBP 3'UTR Luciferase Stable Cell Line |
TU004671 |
ABM |
1.0 ml |
EUR 1521 |
Cnbp 3'UTR Luciferase Stable Cell Line |
TU104084 |
ABM |
1.0 ml |
Ask for price |
CNBP 3'UTR GFP Stable Cell Line |
TU054671 |
ABM |
1.0 ml |
EUR 1521 |
Cnbp 3'UTR GFP Stable Cell Line |
TU252531 |
ABM |
1.0 ml |
Ask for price |
CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody |
20-abx123518 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody |
20-abx111452 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody |
20-abx149425 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody |
abx031491-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody |
abx031491-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody |
20-abx301160 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CCHC-Type Zinc Finger Nucleic Acid Binding Protein (CNBP) Antibody |
abx231793-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
CNBP Rabbit Polyclonal Antibody