CNNM3 Rabbit Polyclonal Antibody

CNNM3 Rabbit Polyclonal Antibody

CNNM3 Polyclonal Antibody

ABP58209-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CNNM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNNM3 from Human. This CNNM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM3 protein

CNNM3 Polyclonal Antibody

ABP58209-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CNNM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNNM3 from Human. This CNNM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM3 protein

CNNM3 Polyclonal Antibody

ABP58209-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNNM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNNM3 from Human. This CNNM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM3 protein

CNNM3 Rabbit pAb

A4625-100ul 100 ul
EUR 308

CNNM3 Rabbit pAb

A4625-200ul 200 ul
EUR 459

CNNM3 Rabbit pAb

A4625-20ul 20 ul
EUR 183

CNNM3 Rabbit pAb

A4625-50ul 50 ul
EUR 223

Metal Transporter CNNM3 (CNNM3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

abx031044-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

abx031044-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody

abx231803-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNNM3 Antibody

ABD2572 100 ug
EUR 438

CNNM3 Antibody

35704-100ul 100ul
EUR 252

CNNM3 antibody

10R-1705 100 ug
EUR 512
Description: Mouse monoclonal CNNM3 antibody

CNNM3 antibody

70R-16477 50 ul
EUR 435
Description: Rabbit polyclonal CNNM3 antibody

CNNM3 Antibody

DF2572 200ul
EUR 304
Description: CNNM3 antibody detects endogenous levels of total CNNM3.

CNNM3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNNM3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200

CNNM3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CNNM3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Metal Transporter CNNM3 (CNNM3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Metal Transporter CNNM3 (CNNM3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CNNM3 Conjugated Antibody

C35704 100ul
EUR 397

anti- CNNM3 antibody

FNab01803 100µg
EUR 505.25
  • Immunogen: cyclin M3
  • Uniprot ID: Q8NE01
  • Gene ID: 26505
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CNNM3

Anti-CNNM3 antibody

PAab01803 100 ug
EUR 355

Anti-CNNM3 antibody

STJ116252 100 µl
EUR 277

Anti-CNNM3 antibody

STJ191904 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNNM3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17374 2 ug
EUR 258

CNNM3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CNNM3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CNNM3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Metal transporter CNNM3, Cnnm3 ELISA KIT

ELI-46826m 96 Tests
EUR 865

Human Metal transporter CNNM3, CNNM3 ELISA KIT

ELI-31876h 96 Tests
EUR 824

Human Metal Transporter CNNM3 (CNNM3) ELISA Kit

abx386601-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

CNNM3 Blocking Peptide

DF2572-BP 1mg
EUR 195

CNNM3 cloning plasmid

CSB-CL843333HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atgctggacgccagcaccgtgctggacttcggcgtcctggccagcatcatgcagagcggccacacgcgcatcccggtgtacgaggaggagcgctccaacatcgtggacatgctctacctcaaggacttggccttcgtggatcccgaagactgcacgccgctcagcaccatcactc
  • Show more
Description: A cloning plasmid for the CNNM3 gene.

Mouse CNNM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF008756 96 Tests
EUR 689

Human CNNM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNNM3 Recombinant Protein (Human)

RP007498 100 ug Ask for price

CNNM3 Recombinant Protein (Rat)

RP195617 100 ug Ask for price

CNNM3 Recombinant Protein (Mouse)

RP125024 100 ug Ask for price

CNNM3 Recombinant Protein (Mouse)

RP125027 100 ug Ask for price

CNNM3 ORF Vector (Human) (pORF)

ORF002500 1.0 ug DNA
EUR 95

Cnnm3 ORF Vector (Rat) (pORF)

ORF065207 1.0 ug DNA
EUR 506

Cnnm3 ORF Vector (Mouse) (pORF)

ORF041676 1.0 ug DNA
EUR 506

Cnnm3 ORF Vector (Mouse) (pORF)

ORF041677 1.0 ug DNA
EUR 506

CNNM3 sgRNA CRISPR Lentivector set (Human)

K0476201 3 x 1.0 ug
EUR 339

Cnnm3 sgRNA CRISPR Lentivector set (Mouse)

K3456001 3 x 1.0 ug
EUR 339

Cnnm3 sgRNA CRISPR Lentivector set (Rat)

K6684801 3 x 1.0 ug
EUR 339

Rat Cyclin M3(CNNM3) ELISA Kit

QY-E11755 96T
EUR 374

CNNM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0476202 1.0 ug DNA
EUR 154

CNNM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0476203 1.0 ug DNA
EUR 154

CNNM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0476204 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3456002 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3456003 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3456004 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6684802 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6684803 1.0 ug DNA
EUR 154

Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6684804 1.0 ug DNA
EUR 154

CNNM3 Protein Vector (Mouse) (pPB-C-His)

PV166702 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPB-N-His)

PV166703 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-HA)

PV166704 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-His)

PV166705 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPB-C-His)

PV166706 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPB-N-His)

PV166707 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-HA)

PV166708 500 ng
EUR 1065

CNNM3 Protein Vector (Mouse) (pPM-C-His)

PV166709 500 ng
EUR 1065

CNNM3 Protein Vector (Human) (pPB-C-His)

PV009997 500 ng
EUR 329

CNNM3 Protein Vector (Human) (pPB-N-His)

PV009998 500 ng
EUR 329

CNNM3 Protein Vector (Human) (pPM-C-HA)

PV009999 500 ng
EUR 329

CNNM3 Protein Vector (Human) (pPM-C-His)

PV010000 500 ng
EUR 329

CNNM3 Protein Vector (Rat) (pPB-C-His)

PV260826 500 ng
EUR 1191

CNNM3 Protein Vector (Rat) (pPB-N-His)

PV260827 500 ng
EUR 1191

CNNM3 Protein Vector (Rat) (pPM-C-HA)

PV260828 500 ng
EUR 1191

CNNM3 Protein Vector (Rat) (pPM-C-His)

PV260829 500 ng
EUR 1191

Cnnm3 3'UTR Luciferase Stable Cell Line

TU202552 1.0 ml Ask for price

Cnnm3 3'UTR GFP Stable Cell Line

TU154106 1.0 ml Ask for price

CNNM3 3'UTR Luciferase Stable Cell Line

TU004695 1.0 ml
EUR 1394

Cnnm3 3'UTR Luciferase Stable Cell Line

TU104106 1.0 ml Ask for price

CNNM3 3'UTR GFP Stable Cell Line

TU054695 1.0 ml
EUR 1394

Cnnm3 3'UTR GFP Stable Cell Line

TU252552 1.0 ml Ask for price

CNNM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651445 1.0 ug DNA
EUR 1355

CNNM3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651449 1.0 ug DNA
EUR 1355

CNNM3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651450 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CNNM3 Rabbit Polyclonal Antibody