CUL4A Rabbit Polyclonal Antibody

CUL4A Rabbit Polyclonal Antibody

CUL4A Polyclonal Antibody

ES10532-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CUL4A from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CUL4A Rabbit pAb

A13911-100ul 100 ul
EUR 308

CUL4A Rabbit pAb

A13911-200ul 200 ul
EUR 459

CUL4A Rabbit pAb

A13911-20ul 20 ul
EUR 183

CUL4A Rabbit pAb

A13911-50ul 50 ul
EUR 223

CUL4A Rabbit pAb

A6199-100ul 100 ul
EUR 308

CUL4A Rabbit pAb

A6199-200ul 200 ul
EUR 459

CUL4A Rabbit pAb

A6199-20ul 20 ul Ask for price

CUL4A Rabbit pAb

A6199-50ul 50 ul Ask for price

CUL4A Rabbit pAb

A2882-100ul 100 ul
EUR 308

CUL4A Rabbit pAb

A2882-200ul 200 ul
EUR 459

CUL4A Rabbit pAb

A2882-20ul 20 ul
EUR 183

CUL4A Rabbit pAb

A2882-50ul 50 ul
EUR 223

CUL4A Antibody

31175-100ul 100ul
EUR 252

CUL4A Antibody

31175-50ul 50ul
EUR 187

CUL4A antibody

70R-16673 50 ul
EUR 435
Description: Rabbit polyclonal CUL4A antibody

CUL4A antibody

70R-10348 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CUL4A antibody

CUL4A antibody

38477-100ul 100ul
EUR 252

CUL4A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CUL4A. Recognizes CUL4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

CUL4A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CUL4A. Recognizes CUL4A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CUL4A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CUL4A. Recognizes CUL4A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CUL4A Antibody

DF7092 200ul
EUR 304
Description: CUL4A Antibody detects endogenous levels of total CUL4A.

CUL4A Antibody

DF2321 200ul
EUR 304
Description: CUL4A antibody detects endogenous levels of total CUL4A.

CUL4A Antibody

AF7538 200ul
EUR 376
Description: CUL4A Antibody detects endogenous levels of CUL4A.

CUL4A Antibody

ABD2321 100 ug
EUR 438

CUL4A Antibody

ABD7092 100 ug
EUR 438

Polyclonal CUL4A Antibody (N-term)

APR03880G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CUL4A (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal CUL4A antibody - middle region

APR01484G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CUL4A - middle region. This antibody is tested and proven to work in the following applications:

CUL4A (Phospho-Ser40) Polyclonal Conjugated Antibody

C12903 100ul
EUR 397

CUL4A Conjugated Antibody

C31175 100ul
EUR 397

anti- CUL4A antibody

FNab02076 100µg
EUR 505.25
  • Immunogen: cullin 4A
  • Uniprot ID: Q13619
  • Gene ID: 8451
  • Research Area: Metabolism
Description: Antibody raised against CUL4A

anti- CUL4A antibody

FNab02077 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: cullin 4A
  • Uniprot ID: Q13619
  • Gene ID: 8451
  • Research Area: Metabolism
Description: Antibody raised against CUL4A

Anti-CUL4A antibody

PAab02076 100 ug
EUR 355

Anti-CUL4A antibody

STJ28181 100 µl
EUR 277

Anti-CUL4A antibody

STJ115848 100 µl
EUR 277

Anti-CUL4A antibody

STJ23293 100 µl
EUR 277

Anti-CUL4A antibody

STJ191690 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CUL4A

Polyclonal Cullin 4A / CUL4A Antibody (N-Terminus)

APR02210G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cullin 4A / CUL4A (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Cullin 4A (CUL4A) Antibody (N-term)

APR05941G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cullin 4A (CUL4A) (N-term). This antibody is tested and proven to work in the following applications:

Rabbit Cullin 4A(CUL4A) ELISA kit

E04C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin 4A(CUL4A) ELISA kit

E04C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin 4A(CUL4A) ELISA kit

E04C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CUL4A (Phospho-Ser40) Antibody

12903-100ul 100ul
EUR 252

CUL4A (Phospho-Ser40) Antibody

12903-50ul 50ul
EUR 187

CUL4A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CUL4A. Recognizes CUL4A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CUL4A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CUL4A. Recognizes CUL4A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CUL4A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CUL4A. Recognizes CUL4A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cullin 4A (CUL4A) Antibody

abx027660-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody

abx027660-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody

abx122598-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phospho-CUL4A(Ser40) Antibody

AF7038 200ul
EUR 376
Description: Phospho-CUL4A(Ser40) Antibody detects endogenous levels of CUL4A only when phosphorylated at Ser40.

Cullin 4A (CUL4A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody

abx232076-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cullin 4A (CUL4A) Antibody

abx232077-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Cullin 4A (CUL4A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- CUL4A-Specific antibody

FNab02078 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: cullin 4A
  • Uniprot ID: Q13619
  • Research Area: Metabolism
Description: Antibody raised against CUL4A-Specific

Anti-CUL4A-Specific antibody

PAab02078 100 ug
EUR 355

CUL4A Blocking Peptide

33R-8573 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CUL4A antibody, catalog no. 70R-10348

CUL4A Blocking Peptide

DF7092-BP 1mg
EUR 195

CUL4A Blocking Peptide

DF2321-BP 1mg
EUR 195

CUL4A Blocking Peptide

AF7538-BP 1mg
EUR 195

CUL4A cloning plasmid

CSB-CL619782HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1980
  • Sequence: atgctctacaagcaactgcgtcaggcctgtgaagaccacgtccaggcacagatccttccgtttagagaagactcactagatagtgttttatttttaaagaagattaacacgtgctggcaggaccactgcagacaaatgatcatgatcagaagcatcttcctgttcttggaccgca
  • Show more
Description: A cloning plasmid for the CUL4A gene.

Anti-Cullin 4a/CUL4A Antibody

A01579-1 100ug/vial
EUR 294

Cullin 4A (CUL4A) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cullin 4A (CUL4A) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cullin 4A-Specific (CUL4A) Antibody

abx232078-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.


EF008919 96 Tests
EUR 689

Human CUL4A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CUL4A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CUL4A Recombinant Protein (Human)

RP008389 100 ug Ask for price

CUL4A Recombinant Protein (Rat)

RP196820 100 ug Ask for price

CUL4A Recombinant Protein (Mouse)

RP126773 100 ug Ask for price

Phospho-CUL4A(Ser40) Blocking Peptide

AF7038-BP 1mg
EUR 195

Cul4a ORF Vector (Rat) (pORF)

ORF065608 1.0 ug DNA
EUR 506

CUL4A ORF Vector (Human) (pORF)

ORF002797 1.0 ug DNA
EUR 95

Cul4a ORF Vector (Mouse) (pORF)

ORF042259 1.0 ug DNA
EUR 506

Rat Cullin 4A(CUL4A) ELISA kit

E02C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cullin 4A(CUL4A) ELISA kit

E02C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cullin 4A(CUL4A) ELISA kit

E02C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 4A(CUL4A) ELISA kit

E03C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 4A(CUL4A) ELISA kit

E03C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 4A(CUL4A) ELISA kit

E03C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 4A(CUL4A) ELISA kit

E06C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 4A(CUL4A) ELISA kit

E06C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 4A(CUL4A) ELISA kit

E06C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin 4A(CUL4A) ELISA kit

E01C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin 4A(CUL4A) ELISA kit

E01C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin 4A(CUL4A) ELISA kit

E01C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 4A(CUL4A) ELISA kit

E09C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 4A(CUL4A) ELISA kit

E09C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 4A(CUL4A) ELISA kit

E09C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 4A(CUL4A) ELISA kit

E08C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 4A(CUL4A) ELISA kit

E08C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 4A(CUL4A) ELISA kit

E08C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 4A(CUL4A) ELISA kit

E07C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 4A(CUL4A) ELISA kit

E07C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 4A(CUL4A) ELISA kit

E07C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin- 4A, CUL4A ELISA KIT

ELI-09098h 96 Tests
EUR 824

Mouse Cullin- 4A, Cul4a ELISA KIT

ELI-25945m 96 Tests
EUR 865

Human Cullin 4A (CUL4A) ELISA Kit

abx386738-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Cul4a sgRNA CRISPR Lentivector set (Rat)

K6159001 3 x 1.0 ug
EUR 339

Cul4a sgRNA CRISPR Lentivector set (Mouse)

K4446701 3 x 1.0 ug
EUR 339

CUL4A sgRNA CRISPR Lentivector set (Human)

K2820701 3 x 1.0 ug
EUR 339

Human Cullin 4A(CUL4A)ELISA Kit

QY-E05015 96T
EUR 361

Guinea pig Cullin 4A(CUL4A) ELISA kit

E05C2184-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cullin 4A(CUL4A) ELISA kit

E05C2184-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cullin 4A(CUL4A) ELISA kit

E05C2184-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 4A(CUL4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cul4a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6159002 1.0 ug DNA
EUR 154

Cul4a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6159003 1.0 ug DNA
EUR 154

Cul4a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6159004 1.0 ug DNA
EUR 154

Cul4a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4446702 1.0 ug DNA
EUR 154

Cul4a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4446703 1.0 ug DNA
EUR 154

Cul4a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4446704 1.0 ug DNA
EUR 154

CUL4A sgRNA CRISPR Lentivector (Human) (Target 1)

K2820702 1.0 ug DNA
EUR 154

CUL4A sgRNA CRISPR Lentivector (Human) (Target 2)

K2820703 1.0 ug DNA
EUR 154

CUL4A sgRNA CRISPR Lentivector (Human) (Target 3)

K2820704 1.0 ug DNA
EUR 154

CUL4A Protein Vector (Mouse) (pPB-C-His)

PV169034 500 ng
EUR 1065

CUL4A Protein Vector (Mouse) (pPB-N-His)

PV169035 500 ng
EUR 1065

CUL4A Protein Vector (Mouse) (pPM-C-HA)

PV169036 500 ng
EUR 1065

CUL4A Protein Vector (Mouse) (pPM-C-His)

PV169037 500 ng
EUR 1065

CUL4A Protein Vector (Rat) (pPB-C-His)

PV262430 500 ng
EUR 1166

CUL4A Protein Vector (Rat) (pPB-N-His)

PV262431 500 ng
EUR 1166

CUL4A Protein Vector (Rat) (pPM-C-HA)

PV262432 500 ng
EUR 1166

CUL4A Protein Vector (Rat) (pPM-C-His)

PV262433 500 ng
EUR 1166

CUL4A Protein Vector (Human) (pPB-C-His)

PV011185 500 ng
EUR 329

CUL4A Protein Vector (Human) (pPB-N-His)

PV011186 500 ng
EUR 329

CUL4A Protein Vector (Human) (pPM-C-HA)

PV011187 500 ng
EUR 329

CUL4A Protein Vector (Human) (pPM-C-His)

PV011188 500 ng
EUR 329

Cul4a 3'UTR GFP Stable Cell Line

TU154555 1.0 ml Ask for price

Cul4a 3'UTR Luciferase Stable Cell Line

TU104555 1.0 ml Ask for price

Cul4a 3'UTR Luciferase Stable Cell Line

TU202967 1.0 ml Ask for price

Cul4a 3'UTR GFP Stable Cell Line

TU252967 1.0 ml Ask for price

CUL4A 3'UTR GFP Stable Cell Line

TU055279 1.0 ml
EUR 1521

CUL4A 3'UTR Luciferase Stable Cell Line

TU005279 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

CUL4A Rabbit Polyclonal Antibody