DYRK2 Rabbit Polyclonal Antibody

DYRK2 Rabbit Polyclonal Antibody

DYRK2 Polyclonal Antibody

ABP58441-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

DYRK2 Polyclonal Antibody

ABP58441-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

DYRK2 Polyclonal Antibody

ABP58441-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein

Polyclonal DYRK2 Antibody

AMM06984G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 . This antibody is tested and proven to work in the following applications:

DYRK2 Polyclonal Antibody

ES8952-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Polyclonal Antibody

ES8952-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Polyclonal Antibody

ES10813-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Polyclonal Antibody

ES10813-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DYRK2 Rabbit pAb

A7012-100ul 100 ul
EUR 308

DYRK2 Rabbit pAb

A7012-200ul 200 ul
EUR 459

DYRK2 Rabbit pAb

A7012-20ul 20 ul
EUR 183

DYRK2 Rabbit pAb

A7012-50ul 50 ul
EUR 223

DYRK2 Polyclonal Conjugated Antibody

C42670 100ul
EUR 397

DYRK2 Antibody

25289-100ul 100ul
EUR 390

DYRK2 Antibody

1-CSB-PA852896ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DYRK2. Recognizes DYRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DYRK2 Antibody

DF10136 200ul
EUR 304
Description: DYRK2 Antibody detects endogenous levels of total DYRK2.

DYRK2 Antibody

ABD10136 100 ug
EUR 438

Polyclonal DYRK2 Antibody (C-Terminus)

AMM06986G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal DYRK2 Antibody (N-term)

APR14269G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Dyrk2 Antibody (C-term)

APR17418G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Dyrk2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal DYRK2 antibody - C-terminal region

AMM06987G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 - C-terminal region. This antibody is tested and proven to work in the following applications:

DYRK2/4 Antibody

DF10330 200ul
EUR 304
Description: DYRK2/4 Antibody detects endogenous levels of DYRK2/4.

Anti-DYRK2 antibody

STJ29092 100 µl
EUR 277
Description: DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert.

Anti-DYRK2 Antibody

STJ500807 100 µg
EUR 476

Anti-DYRK2 antibody

STJ190110 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2

Anti-DYRK2 antibody

STJ191971 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2

DYRK2 siRNA

20-abx914829
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYRK2 siRNA

20-abx914830
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-DYRK2 Antibody (Biotin)

STJ500808 100 µg
EUR 586

Anti-DYRK2 Antibody (FITC)

STJ500809 100 µg
EUR 586

DYRK2/4 (Phospho-Tyr386/268) Polyclonal Conjugated Antibody

C12498 100ul
EUR 397

DYRK2 Blocking Peptide

DF10136-BP 1mg
EUR 195

DYRK2 cloning plasmid

CSB-CL852896HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atgaatgatcacctgcatgtcggcagccacgctcacggacagatccaggttcaacagttgtttgaggataacagtaacaagcggacagtgctcacgacacaaccaaatgggcttacaacagtgggcaaaacgggcttgccagtggtgccagagcggcagctggacagcattcata
  • Show more
Description: A cloning plasmid for the DYRK2 gene.

DYRK2 cloning plasmid

CSB-CL852896HU2-10ug 10ug
EUR 615
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1806
  • Sequence: atgttaaccaggaaaccttcggccgccgctcccgccgcctacccgaccggccgaggtggggacagcgccgttcgtcagcttcaggcttccccggggctcggtgcaggggccacccggagcggagtggggactggcccgccctcccccatcgccctgccgcctctccgggccagca
  • Show more
Description: A cloning plasmid for the DYRK2 gene.

pCDNA3.1-Dyrk2-m

PVT14259 2 ug
EUR 599

Anti-DYRK2 (2F9)

YF-MA11064 50 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (3G5)

YF-MA16355 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (6E2)

YF-MA16356 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (4G11)

YF-MA16357 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2

Anti-DYRK2 (2F9)

YF-MA16358 200 ul
EUR 363
Description: Mouse monoclonal to DYRK2

DYRK2 / 4 (pY386 / 268) Antibody

abx149950-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Monoclonal DYRK2 Antibody, Clone: 492CT4.2.4

AMM06985G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human DYRK2. The antibodies are raised in Mouse and are from clone 492CT4.2.4. This antibody is applicable in WB, E

DYRK2/4 Blocking Peptide

DF10330-BP 1mg
EUR 195

Chicken DYRK2 ELISA KIT

ELI-09351c 96 Tests
EUR 928

Human DYRK2 ELISA KIT

ELI-31566h 96 Tests
EUR 824

Mouse DYRK2 shRNA Plasmid

20-abx976876
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DYRK2 shRNA Plasmid

20-abx955533
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Dyrk2 ELISA KIT

ELI-48130m 96 Tests
EUR 865

pCMV-HA-DYRK2 Plasmid

PVTB00719-2a 2 ug
EUR 356

DYRK2/4 (Phospho-Tyr386/268) Antibody

12498-100ul 100ul
EUR 252

DYRK2/4 (Phospho-Tyr386/268) Antibody

12498-50ul 50ul
EUR 187

Phospho-DYRK2/4 (Tyr386/268) Antibody

AF8142 200ul
EUR 376
Description: DYRK2/4 (Phospho-Tyr386/268) Antibody detects endogenous levels of DYRK2/4 only when phosphorylated at Tyr386/268.

DYRK2/4 (Phospho- Tyr386/268) Antibody

ABF8142 100 ug
EUR 438

Dyrk2 ORF Vector (Rat) (pORF)

ORF066306 1.0 ug DNA
EUR 506

h DYRK2 inducible lentiviral particles

LVP152 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, DYRK2, is fully sequence verified and matched to NCBI accession ID: NM_003583

DYRK2 ORF Vector (Human) (pORF)

ORF003350 1.0 ug DNA
EUR 95

DYRK2 ORF Vector (Human) (pORF)

ORF003351 1.0 ug DNA
EUR 95

Dyrk2 ORF Vector (Mouse) (pORF)

ORF043492 1.0 ug DNA
EUR 506

pECMV-Dyrk2-m-Myc-FLAG

PVT14273 2 ug
EUR 599

Dyrk2 sgRNA CRISPR Lentivector set (Rat)

K6229301 3 x 1.0 ug
EUR 339

DYRK2 sgRNA CRISPR Lentivector set (Human)

K0645201 3 x 1.0 ug
EUR 339

Dyrk2 sgRNA CRISPR Lentivector set (Mouse)

K3457601 3 x 1.0 ug
EUR 339

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx025430-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx025430-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

20-abx005313
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx122510-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx033457-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

abx033457-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 2 (DYRK2) Antibody

20-abx320190
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-DYRK2/4 (Tyr386/268) Blocking Peptide

AF8142-BP 1mg
EUR 195

DYRK2 Rabbit Polyclonal Antibody