EMID2 Rabbit Polyclonal Antibody

EMID2 Rabbit Polyclonal Antibody

EMID2 Antibody

44513-100ul 100ul
EUR 252

EMID2 Antibody

44513-50ul 50ul
EUR 187

EMID2 Antibody

DF10102 200ul
EUR 304
Description: EMID2 Antibody detects endogenous levels of total EMID2.

EMID2 antibody

70R-7507 50 ug
EUR 467
Description: Rabbit polyclonal EMID2 antibody raised against the C terminal of EMID2

EMID2 antibody

70R-7529 50 ug
EUR 467
Description: Rabbit polyclonal EMID2 antibody raised against the C terminal of EMID2

EMID2 Antibody

ABD10102 100 ug
EUR 438

EMID2 Conjugated Antibody

C44513 100ul
EUR 397

Anti-EMID2 antibody

STJ191843 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EMID2

Rabbit Collagen alpha-1(EMID2) ELISA kit

E04C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen alpha-1(EMID2) ELISA kit

E04C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen alpha-1(EMID2) ELISA kit

E04C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

EMID2 Blocking Peptide

33R-3653 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EMID2 antibody, catalog no. 70R-7529

EMID2 Blocking Peptide

33R-4766 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EMID2 antibody, catalog no. 70R-7507

EMID2 Blocking Peptide

DF10102-BP 1mg
EUR 195

EMID2 cloning plasmid

CSB-CL853381HU1-10ug 10ug
EUR 479
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: ATGAAGCTGGCCCTGCTCCTGCCCTGGGCGTGTTGCTGCCTCTGCGGGTCGGCGCTGGCCACCGGCTTCCTCTATCCCTTCTCGGCCGCAGCTCTGCAGCAGCACGGCTACCCCGAGCCCGGCGCCGGCTCCCCTGGCAGCGGCTACGCGAGCCGCCGGCACTGGTGCCATCACA
  • Show more
Description: A cloning plasmid for the EMID2 gene.

EMID2 cloning plasmid

CSB-CL853381HU2-10ug 10ug
EUR 479
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: ATGAAGCTGGCCCTGCTCCTGCCCTGGGCGTGTTGCTGCCTCTGCGGGTCGGCGCTGGCCACTGGCTTTCTCTATCCCTTCTCGGCCGCAGCTCTGCAGCAGCACGGCTACCCCGAGCCCGGCGCCGGCTCCCCTGGCAGCGGCTACGCGAGCCGCCGGCACTGGTGCCATCACA
  • Show more
Description: A cloning plasmid for the EMID2 gene.

anti-Anti-EMID2

YF-PA26883 50 ul
EUR 334
Description: Mouse polyclonal to Anti-EMID2

EMID2 Recombinant Protein (Human)

RP038746 100 ug Ask for price

EMID2 Recombinant Protein (Human)

RP038749 100 ug Ask for price

EMID2 Recombinant Protein (Mouse)

RP131624 100 ug Ask for price

EMI Domain-Containing Protein 2 (EMID2) Antibody

20-abx215146
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EMI Domain-Containing Protein 2 (EMID2) Antibody

abx029671-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

EMI Domain-Containing Protein 2 (EMID2) Antibody

abx029671-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EMID2 ORF Vector (Human) (pORF)

ORF012916 1.0 ug DNA
EUR 354

EMID2 ORF Vector (Human) (pORF)

ORF012917 1.0 ug DNA
EUR 354

Emid2 ORF Vector (Mouse) (pORF)

ORF043876 1.0 ug DNA
EUR 506

EMID2 sgRNA CRISPR Lentivector set (Human)

K0678001 3 x 1.0 ug
EUR 339

Emid2 sgRNA CRISPR Lentivector set (Mouse)

K4043201 3 x 1.0 ug
EUR 339

Rat Collagen alpha-1(EMID2) ELISA kit

E02C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Collagen alpha-1(EMID2) ELISA kit

E02C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Collagen alpha-1(EMID2) ELISA kit

E02C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Collagen alpha-1(EMID2) ELISA kit

E03C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Collagen alpha-1(EMID2) ELISA kit

E03C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Collagen alpha-1(EMID2) ELISA kit

E03C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Collagen alpha-1(EMID2) ELISA kit

E06C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Collagen alpha-1(EMID2) ELISA kit

E06C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Collagen alpha-1(EMID2) ELISA kit

E06C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagen alpha-1(EMID2) ELISA kit

E01C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagen alpha-1(EMID2) ELISA kit

E01C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagen alpha-1(EMID2) ELISA kit

E01C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Collagen alpha-1(EMID2) ELISA kit

E09C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Collagen alpha-1(EMID2) ELISA kit

E09C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Collagen alpha-1(EMID2) ELISA kit

E09C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Collagen alpha-1(EMID2) ELISA kit

E08C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Collagen alpha-1(EMID2) ELISA kit

E08C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Collagen alpha-1(EMID2) ELISA kit

E08C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Collagen alpha-1(EMID2) ELISA kit

E07C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Collagen alpha-1(EMID2) ELISA kit

E07C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Collagen alpha-1(EMID2) ELISA kit

E07C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

EMID2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0678002 1.0 ug DNA
EUR 154

EMID2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0678003 1.0 ug DNA
EUR 154

EMID2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0678004 1.0 ug DNA
EUR 154

Emid2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4043202 1.0 ug DNA
EUR 154

Emid2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4043203 1.0 ug DNA
EUR 154

Emid2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4043204 1.0 ug DNA
EUR 154

EMID2 Protein Vector (Mouse) (pPB-C-His)

PV175502 500 ng
EUR 603

EMID2 Protein Vector (Mouse) (pPB-N-His)

PV175503 500 ng
EUR 603

EMID2 Protein Vector (Mouse) (pPM-C-HA)

PV175504 500 ng
EUR 603

EMID2 Protein Vector (Mouse) (pPM-C-His)

PV175505 500 ng
EUR 603

EMID2 Protein Vector (Human) (pPB-C-His)

PV051661 500 ng
EUR 481

EMID2 Protein Vector (Human) (pPB-N-His)

PV051662 500 ng
EUR 481

EMID2 Protein Vector (Human) (pPM-C-HA)

PV051663 500 ng
EUR 481

EMID2 Protein Vector (Human) (pPM-C-His)

PV051664 500 ng
EUR 481

EMID2 Protein Vector (Human) (pPB-C-His)

PV051665 500 ng
EUR 481

EMID2 Protein Vector (Human) (pPB-N-His)

PV051666 500 ng
EUR 481

EMID2 Protein Vector (Human) (pPM-C-HA)

PV051667 500 ng
EUR 481

EMID2 Protein Vector (Human) (pPM-C-His)

PV051668 500 ng
EUR 481

Emid2 3'UTR GFP Stable Cell Line

TU155792 1.0 ml Ask for price

Emid2 3'UTR Luciferase Stable Cell Line

TU105792 1.0 ml Ask for price

EMID2 3'UTR GFP Stable Cell Line

TU056863 1.0 ml
EUR 1394

EMID2 3'UTR Luciferase Stable Cell Line

TU006863 1.0 ml
EUR 1394

Guinea pig Collagen alpha-1(EMID2) ELISA kit

E05C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

EMID2 Rabbit Polyclonal Antibody