Da vinci european bio bank

FGF14 Rabbit Polyclonal Antibody

FGF14 Polyclonal Antibody
ABP58546-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FGF14 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of FGF14 from Human, Mouse, Rat. This FGF14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF14 protein at amino acid sequence of 10-90

FGF14 Rabbit pAb
A6588-100ul	Abclonal	100 ul	EUR 308

FGF14 Rabbit pAb
A6588-200ul	Abclonal	200 ul	EUR 459

FGF14 Rabbit pAb
A6588-20ul	Abclonal	20 ul	EUR 183

FGF14 Rabbit pAb
A6588-50ul	Abclonal	50 ul	EUR 223

FGF14 antibody
70R-9286	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal FGF14 antibody

FGF14 Antibody
ABD13097	Lifescience Market	100 ug	EUR 438

FGF14 Antibody
ABD2494	Lifescience Market	100 ug	EUR 438

FGF14 antibody
39028-100ul	SAB	100ul	EUR 252

FGF14 Antibody
DF2494	Affbiotech	200ul	EUR 304
Description: FGF14 antibody detects endogenous levels of total FGF14.

FGF14 Antibody
1-CSB-PA008620ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF14. Recognizes FGF14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

FGF14 Conjugated Antibody
C39028	SAB	100ul	EUR 397

Anti-FGF14 antibody
STJ28671	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene.

Anti-FGF14 antibody
STJ191846	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FGF14

Fgf14/ Rat Fgf14 ELISA Kit
ELI-07770r	Lifescience Market	96 Tests	EUR 886

FGF14 siRNA
20-abx901945	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FGF14 siRNA
20-abx916805	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FGF14 siRNA
20-abx916806	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-FGF14
YF-PA23709	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to FGF14

Polyclonal Fgf14 (mouse N terminus) Antibody (N-Term)
APR11926G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Fgf14 (mouse N terminus) (N-Term). This antibody is tested and proven to work in the following applications:

FGF14 cloning plasmid
CSB-CL008620HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 759 Sequence: ATGGTAAAACCGGTGCCCCTCTTCAGGAGAACTGATTTCAAATTATTATTATGCAACCACAAGGATCTCTTCTTTCTCAGGGTGTCTAAGCTGCTGGATTGCTTTTCGCCCAAATCAATGTGGTTTCTTTGGAACATTTTCAGCAAAGGAACGCATATGCTGCAGTGTCTTTGTGG Show more
Description: A cloning plasmid for the FGF14 gene.

FGF14, human recombinant
7347-50	Biovision		EUR 457

FGF14 Blocking Peptide
33R-2622	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FGF14 antibody, catalog no. 70R-9286

FGF14 Blocking Peptide
DF2494-BP	Affbiotech	1mg	EUR 195

Rat FGF14 shRNA Plasmid
20-abx986101	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FGF14 protein (His tag)
80R-2833	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant FGF14 protein (His tag)

Mouse FGF14 shRNA Plasmid
20-abx970318	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FGF14 shRNA Plasmid
20-abx951579	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Fibroblast Growth Factor 14 (FGF14) Antibody
abx148512-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Fibroblast Growth Factor 14 (FGF14) Antibody
20-abx005054	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fibroblast Growth Factor 14 (FGF14) Antibody
20-abx321798	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Fibroblast Growth Factor 14 (Fgf14) Antibody
abx431250-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Fibroblast Growth Factor 14 (FGF14) Antibody
20-abx225169	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Anti-Fgf14 (mouse N terminus) antibody
STJ72909	St John's Laboratory	100 µg	EUR 359

Fgf14 ORF Vector (Rat) (pORF)
ORF067094	ABM	1.0 ug DNA	EUR 506

Fgf14 ORF Vector (Mouse) (pORF)
ORF044815	ABM	1.0 ug DNA	EUR 506

Fgf14 ORF Vector (Mouse) (pORF)
ORF044816	ABM	1.0 ug DNA	EUR 506

FGF14 ORF Vector (Human) (pORF)
ORF013032	ABM	1.0 ug DNA	EUR 354

FGF14 sgRNA CRISPR Lentivector set (Human)
K0778501	ABM	3 x 1.0 ug	EUR 339

Human Fibroblast growth factor 14 (FGF14)
1-CSB-EP008620HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Fibroblast growth factor 14(FGF14) expressed in E.coli

Fgf14 sgRNA CRISPR Lentivector set (Mouse)
K3982801	ABM	3 x 1.0 ug	EUR 339

Fgf14 sgRNA CRISPR Lentivector set (Rat)
K6794701	ABM	3 x 1.0 ug	EUR 339

FGF14-AS1 ORF Vector (Human) (pORF)
ORF019583	ABM	1.0 ug DNA	Ask for price

FGF14-IT1 ORF Vector (Human) (pORF)
ORF019584	ABM	1.0 ug DNA	Ask for price

FGF14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0778502	ABM	1.0 ug DNA	EUR 154

FGF14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0778503	ABM	1.0 ug DNA	EUR 154

FGF14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0778504	ABM	1.0 ug DNA	EUR 154

Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3982802	ABM	1.0 ug DNA	EUR 154

Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3982803	ABM	1.0 ug DNA	EUR 154

Fgf14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3982804	ABM	1.0 ug DNA	EUR 154

Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6794702	ABM	1.0 ug DNA	EUR 154

Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6794703	ABM	1.0 ug DNA	EUR 154

Fgf14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6794704	ABM	1.0 ug DNA	EUR 154

FGF14 Protein Vector (Human) (pPB-C-His)
PV052125	ABM	500 ng	EUR 481

FGF14 Protein Vector (Human) (pPB-N-His)
PV052126	ABM	500 ng	EUR 481

FGF14 Protein Vector (Human) (pPM-C-HA)
PV052127	ABM	500 ng	EUR 481

FGF14 Protein Vector (Human) (pPM-C-His)
PV052128	ABM	500 ng	EUR 481

FGF14 Protein Vector (Mouse) (pPB-C-His)
PV179258	ABM	500 ng	EUR 603

FGF14 Protein Vector (Mouse) (pPB-N-His)
PV179259	ABM	500 ng	EUR 603

FGF14 Protein Vector (Mouse) (pPM-C-HA)
PV179260	ABM	500 ng	EUR 603

FGF14 Protein Vector (Mouse) (pPM-C-His)
PV179261	ABM	500 ng	EUR 603

FGF14 Protein Vector (Mouse) (pPB-C-His)
PV179262	ABM	500 ng	EUR 603

FGF14 Protein Vector (Mouse) (pPB-N-His)
PV179263	ABM	500 ng	EUR 603

FGF14 Protein Vector (Mouse) (pPM-C-HA)
PV179264	ABM	500 ng	EUR 603

FGF14 Protein Vector (Mouse) (pPM-C-His)
PV179265	ABM	500 ng	EUR 603

FGF14 Protein Vector (Rat) (pPB-C-His)
PV268374	ABM	500 ng	EUR 603

FGF14 Protein Vector (Rat) (pPB-N-His)
PV268375	ABM	500 ng	EUR 603

FGF14 Protein Vector (Rat) (pPM-C-HA)
PV268376	ABM	500 ng	EUR 603

FGF14 Protein Vector (Rat) (pPM-C-His)
PV268377	ABM	500 ng	EUR 603

Fgf14 3'UTR Luciferase Stable Cell Line
TU204599	ABM	1.0 ml	Ask for price

Fgf14 3'UTR GFP Stable Cell Line
TU156533	ABM	1.0 ml	Ask for price

FGF14 3'UTR Luciferase Stable Cell Line
TU007928	ABM	1.0 ml	EUR 1394

Fgf14 3'UTR Luciferase Stable Cell Line
TU106533	ABM	1.0 ml	Ask for price

FGF14 3'UTR GFP Stable Cell Line
TU057928	ABM	1.0 ml	EUR 1394

Fgf14 3'UTR GFP Stable Cell Line
TU254599	ABM	1.0 ml	Ask for price

FGF14 Rabbit Polyclonal Antibody