GAR1 Rabbit Polyclonal Antibody

GAR1 Rabbit Polyclonal Antibody

GAR1 Polyclonal Antibody

ABP58607-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of GAR1 from Human, Mouse, Rat. This GAR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190

GAR1 Polyclonal Antibody

ES10659-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GAR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GAR1 Polyclonal Antibody

ES10659-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GAR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GAR1 Rabbit pAb

A12748-100ul 100 ul
EUR 308

GAR1 Rabbit pAb

A12748-200ul 200 ul
EUR 459

GAR1 Rabbit pAb

A12748-20ul 20 ul
EUR 183

GAR1 Rabbit pAb

A12748-50ul 50 ul
EUR 223

GAR1 antibody

70R-17424 50 ul
EUR 435
Description: Rabbit polyclonal GAR1 antibody

GAR1 Antibody

43554-100ul 100ul
EUR 252

GAR1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GAR1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GAR1 Polyclonal Antibody, HRP Conjugated

A67631 100 µg
EUR 570.55
Description: fast delivery possible

GAR1 Polyclonal Antibody, FITC Conjugated

A67632 100 µg
EUR 570.55
Description: reagents widely cited

GAR1 Polyclonal Antibody, Biotin Conjugated

A67633 100 µg
EUR 570.55
Description: Ask the seller for details

GAR1 Conjugated Antibody

C43554 100ul
EUR 397

anti- GAR1 antibody

FNab03346 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: GAR1 ribonucleoprotein homolog(yeast)
  • Uniprot ID: Q9NY12
  • Gene ID: 54433
  • Research Area: Metabolism
Description: Antibody raised against GAR1

Anti-GAR1 antibody

PAab03346 100 ug
EUR 355

Anti-GAR1 antibody

STJ114621 100 µl
EUR 277
Description: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA2 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The encoded protein of this gene contains two glycine- and arginine-rich domains and is related to Saccharomyces cerevisiae Gar1p. Two splice variants have been found for this gene.

Anti-GAR1 antibody

STJ191817 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GAR1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GAR1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GAR1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GAR1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GAR1 cloning plasmid

CSB-CL878917HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atgtcttttcgaggcggaggtcgtggaggctttaatcgaggtggtggaggtggcggcttcaaccgaggcggcagcagcaaccacttccgaggtggaggcggcggtggaggcggcggcaatttcagaggcggcggcaggggaggatttggacgagggggtggccgcggaggctttaa
  • Show more
Description: A cloning plasmid for the GAR1 gene.


PVT12527 2 ug
EUR 391


EF009780 96 Tests
EUR 689

Rat GAR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GAR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GAR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GAR1 Recombinant Protein (Human)

RP012913 100 ug Ask for price

GAR1 Recombinant Protein (Rat)

RP202247 100 ug Ask for price

GAR1 Recombinant Protein (Mouse)

RP135920 100 ug Ask for price

Gar1 ORF Vector (Rat) (pORF)

ORF067417 1.0 ug DNA
EUR 506

GAR1 ORF Vector (Human) (pORF)

ORF004305 1.0 ug DNA
EUR 95

Gar1 ORF Vector (Mouse) (pORF)

ORF045308 1.0 ug DNA
EUR 506

GAR1 ELISA Kit (Human) (OKEH03050)

OKEH03050 96 Wells
EUR 662
Description: Description of target: Subunit of cyclic nucleotide-gated (CNG) channels, nonselective cation channels, which play important roles in both visual and olfactory signal transduction. When associated with CNGA1, it is involved in the regulation of ion flow into the rod photoreceptor outer segment (ROS), in response to light-induced alteration of the levels of intracellular cGMP. Isoform GARP2 is a high affinity rod photoreceptor phosphodiesterase (PDE6)-binding protein that modulates its catalytic properties: it is a regulator of spontaneous activation of rod PDE6, thereby serving to lower rod photoreceptor 'dark noise' and allowing these sensory cells to operate at the single photon detection limit.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.404 ng/mL

H/ACA Ribonucleoprotein Complex Subunit 1 (GAR1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

H/ACA Ribonucleoprotein Complex Subunit 1 (GAR1) Antibody

abx146045-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

H/ACA Ribonucleoprotein Complex Subunit 1 (GAR1) Antibody

abx030979-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

H/ACA Ribonucleoprotein Complex Subunit 1 (GAR1) Antibody

abx030979-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

H/ACA Ribonucleoprotein Complex Subunit 1 (GAR1) Antibody

abx233346-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

H/ACA Ribonucleoprotein Complex Subunit 1 (GAR1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gar1 sgRNA CRISPR Lentivector set (Mouse)

K4667301 3 x 1.0 ug
EUR 339

Gar1 sgRNA CRISPR Lentivector set (Rat)

K6426501 3 x 1.0 ug
EUR 339

GAR1 Rabbit Polyclonal Antibody