GBP2 Rabbit Polyclonal Antibody

GBP2 Rabbit Polyclonal Antibody

GBP2 Polyclonal Antibody

ABP58613-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GBP2 from Human. This GBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240

GBP2 Polyclonal Antibody

ABP58613-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GBP2 from Human. This GBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240

GBP2 Polyclonal Antibody

ABP58613-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GBP2 from Human. This GBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240

GBP2 Rabbit pAb

A12994-100ul 100 ul
EUR 308

GBP2 Rabbit pAb

A12994-200ul 200 ul
EUR 459

GBP2 Rabbit pAb

A12994-20ul 20 ul
EUR 183

GBP2 Rabbit pAb

A12994-50ul 50 ul
EUR 223

Polyclonal GBP2 Antibody (Center)

APR16101G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GBP2 (Center). This antibody is tested and proven to work in the following applications:

GBP2 antibody

70R-5725 50 ug
EUR 467
Description: Rabbit polyclonal GBP2 antibody raised against the N terminal of GBP2

GBP2 antibody

70R-4040 50 ug
EUR 467
Description: Rabbit polyclonal GBP2 antibody raised against the N terminal of GBP2

GBP2 Antibody

ABD2499 100 ug
EUR 438

GBP2 Antibody

44802-100ul 100ul
EUR 252

GBP2 Antibody

44802-50ul 50ul
EUR 187

GBP2 antibody

10R-4184 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody

10R-4186 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody

10R-4188 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody

10R-4191 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody

10R-4192 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody

10R-4193 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody

70R-17437 50 ul
EUR 435
Description: Rabbit polyclonal GBP2 antibody

GBP2 Antibody

DF2499 200ul
EUR 304
Description: GBP2 antibody detects endogenous levels of total GBP2.

GBP2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GBP2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

[KO Validated] GBP2 Rabbit pAb

A19874-100ul 100 ul
EUR 410

[KO Validated] GBP2 Rabbit pAb

A19874-200ul 200 ul
EUR 571

[KO Validated] GBP2 Rabbit pAb

A19874-20ul 20 ul
EUR 221

[KO Validated] GBP2 Rabbit pAb

A19874-50ul 50 ul
EUR 287

GBP2 Conjugated Antibody

C44802 100ul
EUR 397

anti- GBP2 antibody

FNab03374 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IHC: 1:50-1:500
  • Immunogen: guanylate binding protein 2, interferon-inducible
  • Uniprot ID: P32456
  • Gene ID: 2634
  • Research Area: Neuroscience
Description: Antibody raised against GBP2

Anti-GBP2 antibody

PAab03374 100 ug
EUR 355

Anti-GBP2 antibody

STJ11100750 100 µl
EUR 413
Description: This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas.

Anti-GBP2 antibody

STJ114963 100 µl
EUR 277
Description: This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas.

Anti-GBP2 antibody

STJ191848 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GBP2

Gbp2/ Rat Gbp2 ELISA Kit

ELI-27213r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11970 50 ul
EUR 363
Description: Mouse polyclonal to GBP2


YF-PA11971 50 ug
EUR 363
Description: Mouse polyclonal to GBP2


YF-PA11972 100 ul
EUR 403
Description: Rabbit polyclonal to GBP2


YF-PA11973 100 ug
EUR 403
Description: Rabbit polyclonal to GBP2

GBP2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GBP2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GBP2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GBP2 cloning plasmid

CSB-CL009298HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atggctccagagatcaacttgccgggcccaatgagcctcattgataacactaaagggcagctggtggtgaatccagaagctctgaagatcctatctgcaattacgcagcctgtggtggtggtggcgattgtgggcctctatcgcacaggcaaatcctacctgatgaacaagctgg
  • Show more
Description: A cloning plasmid for the GBP2 gene.

GBP2 Blocking Peptide

33R-3862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GBP2 antibody, catalog no. 70R-5725

GBP2 Blocking Peptide

33R-3881 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GBP2 antibody, catalog no. 70R-4040

GBP2 Blocking Peptide

DF2499-BP 1mg
EUR 195

Anti-GBP2 (2A10)

YF-MA13198 100 ug
EUR 363
Description: Mouse monoclonal to GBP2

Rat GBP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gbp2 ELISA KIT

ELI-12519m 96 Tests
EUR 865


ELI-27212h 96 Tests
EUR 824


EF009797 96 Tests
EUR 689

Mouse GBP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GBP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GBP2 Recombinant Protein (Human)

RP012994 100 ug Ask for price

GBP2 Recombinant Protein (Rat)

RP202328 100 ug Ask for price

GBP2 Recombinant Protein (Mouse)

RP136049 100 ug Ask for price

Guanylate Binding Protein 2 (GBP2) Antibody

abx145827-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Guanylate-Binding Protein 2 (GBP2) Antibody

abx034879-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Guanylate-Binding Protein 2 (GBP2) Antibody

abx034879-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Guanylate-Binding Protein 2 (GBP2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guanylate-Binding Protein 2 (GBP2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guanylate Binding Protein 2 (GBP2) Antibody

abx233374-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Monoclonal GBP2 Antibody (clone 5C8), Clone: 5C8

APR16102G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human GBP2 (clone 5C8). The antibodies are raised in Mouse and are from clone 5C8. This antibody is applicable in WB and IHC-P, IF, Flo

Guanylate-Binding Protein 2 (GBP2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guanylate-Binding Protein 2 (GBP2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guanylate-Binding Protein 2 (GBP2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GBP2 ORF Vector (Human) (pORF)

ORF004332 1.0 ug DNA
EUR 95

Gbp2 ORF Vector (Rat) (pORF)

ORF067444 1.0 ug DNA
EUR 506

Gbp2 ORF Vector (Mouse) (pORF)

ORF045351 1.0 ug DNA
EUR 506

Guanylate Binding Protein 2, Interferon Inducible (GBP2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guanylate Binding Protein 2, Interferon Inducible (GBP2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GBP2 sgRNA CRISPR Lentivector set (Human)

K0844801 3 x 1.0 ug
EUR 339

Gbp2 sgRNA CRISPR Lentivector set (Mouse)

K3906501 3 x 1.0 ug
EUR 339

Gbp2 sgRNA CRISPR Lentivector set (Rat)

K7076701 3 x 1.0 ug
EUR 339

Human Guanylate-Binding Protein 2 (GBP2) Protein

  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GBP2 Rabbit Polyclonal Antibody