GRIP1 Rabbit Polyclonal Antibody

GRIP1 Rabbit Polyclonal Antibody

GRIP1 Polyclonal Antibody
ABP58716-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GRIP1 protein at amino acid sequence of 830-910 Applications tips:
Description: A polyclonal antibody for detection of GRIP1 from Human, Mouse, Rat. This GRIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRIP1 protein at amino acid sequence of 830-910

GRIP1 Polyclonal Antibody
ABP58716-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GRIP1 protein at amino acid sequence of 830-910 Applications tips:
Description: A polyclonal antibody for detection of GRIP1 from Human, Mouse, Rat. This GRIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRIP1 protein at amino acid sequence of 830-910

GRIP1 Rabbit pAb
A5747-100ul	Abclonal	100 ul	EUR 308

GRIP1 Rabbit pAb
A5747-200ul	Abclonal	200 ul	EUR 459

GRIP1 Rabbit pAb
A5747-20ul	Abclonal	20 ul	EUR 183

GRIP1 Rabbit pAb
A5747-50ul	Abclonal	50 ul	EUR 223

GRIP1 Rabbit pAb
A16503-100ul	Abclonal	100 ul	EUR 308

GRIP1 Rabbit pAb
A16503-200ul	Abclonal	200 ul	EUR 459

GRIP1 Rabbit pAb
A16503-20ul	Abclonal	20 ul	EUR 183

GRIP1 Rabbit pAb
A16503-50ul	Abclonal	50 ul	EUR 223

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

GRIP1 antibody
70R-7931	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GRIP1 antibody

GRIP1 Antibody
ABD2500	Lifescience Market	100 ug	EUR 438

GRIP1 Antibody
44803-100ul	SAB	100ul	EUR 252

GRIP1 Antibody
44803-50ul	SAB	50ul	EUR 187

GRIP1 antibody
20R-1077	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GRIP1 antibody

GRIP1 Antibody
DF2500	Affbiotech	200ul	EUR 304
Description: GRIP1 antibody detects endogenous levels of total GRIP1.

Polyclonal GRIP1 antibody - C-terminal region
APR12279G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRIP1 - C-terminal region. This antibody is tested and proven to work in the following applications:

GRIP1 Conjugated Antibody
C44803	SAB	100ul	EUR 397

anti- GRIP1 antibody
FNab03650	FN Test	100µg	EUR 548.75
Immunogen: glutamate receptor interacting protein 1 Uniprot ID: Q9Y3R0 Gene ID: 23426 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against GRIP1

Anti-GRIP1 antibody
PAab03650	Lifescience Market	100 ug	EUR 386

Anti-GRIP1 antibody
STJ28314	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the glutamate receptor interacting protein family. The encoded scaffold protein binds to and mediates the trafficking and membrane organization of a number of transmembrane proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-GRIP1 antibody
STJ118942	St John's Laboratory	100 µl	EUR 277

Anti-GRIP1 antibody
STJ191850	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GRIP1

Grip1/ Rat Grip1 ELISA Kit
ELI-42869r	Lifescience Market	96 Tests	EUR 886

GRIP1 siRNA
20-abx902326	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GRIP1 siRNA
20-abx918710	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GRIP1 siRNA
20-abx918711	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GRIP1
YF-PA25886	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GRIP1

GRIP1 Blocking Peptide
33R-6108	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIP1 antibody, catalog no. 20R-1077

GRIP1 Blocking Peptide
33R-8113	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIP1 antibody, catalog no. 70R-7931

GRIP1 Blocking Peptide
DF2500-BP	Affbiotech	1mg	EUR 195

GRIP1 cloning plasmid
CSB-CL897486HU-10ug	Cusabio	10ug	EUR 1154
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3231 Sequence: ATGATAGCTGTCTCTTTTAAATGCCGTTGTCAAATTCTGAGGCGACTTACTAAAGATGAGAGTCCCTACACTAAATCCGCCAGCCAGACAAAGCCGCCTGATGGAGCGTTGGCTGTGAGGAGACAGAGCATCCCAGAGGAATTCAAGGGCTCCACAGTCGTCGAGCTGATGAAGA Show more
Description: A cloning plasmid for the GRIP1 gene.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human)
4-PAB753Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1)

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human)
4-PAB753Hu02	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1)

GRIP1-Associated Protein 1 (GRASP1) Antibody
20-abx125907	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
20-abx112850	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRIPAP1) Antibody
abx332123-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
abx430720-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
abx233651-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC
4-PAB753Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Biotinylated
4-PAB753Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Biotin.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Cy3
4-PAB753Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Cy3.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), FITC
4-PAB753Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with FITC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), HRP
4-PAB753Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with HRP.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), PE
4-PAB753Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with PE.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC
4-PAB753Hu02-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Biotinylated
4-PAB753Hu02-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Biotin.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Cy3
4-PAB753Hu02-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Cy3.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), FITC
4-PAB753Hu02-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with FITC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), HRP
4-PAB753Hu02-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with HRP.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), PE
4-PAB753Hu02-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with PE.

Mouse GRIP1 shRNA Plasmid
20-abx978072	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat GRIP1 shRNA Plasmid
20-abx986893	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GRIP1 ELISA KIT|Human
EF009995	Lifescience Market	96 Tests	EUR 689

Human GRIP1 shRNA Plasmid
20-abx958262	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rabbit Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E04G0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E04G0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E04G0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB753Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Gly874~Glu1073) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC-Cy7.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB753Hu02-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRIP1 (Arg79~Thr268) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC-Cy7.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx148365	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx132386	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx104159	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx104160	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx006798	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
abx233650-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Anti-GRIP1 Associated Protein 1 (GRASP1) antibody
STJ120112	St John's Laboratory	100 µl	EUR 526

Grip1 ORF Vector (Rat) (pORF)
ORF067898	ABM	1.0 ug DNA	EUR 506

Grip1 ORF Vector (Mouse) (pORF)
ORF046679	ABM	1.0 ug DNA	EUR 506

Grip1 ORF Vector (Mouse) (pORF)
ORF046680	ABM	1.0 ug DNA	EUR 506

Grip1 ORF Vector (Mouse) (pORF)
ORF046681	ABM	1.0 ug DNA	EUR 506

GRIP1 ORF Vector (Human) (pORF)
ORF013216	ABM	1.0 ug DNA	EUR 354

GRIP1 ELISA Kit (Human) (OKCD00844)
OKCD00844	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: May play a role as a localized scaffold for the assembly of a multiprotein signaling complex and as mediator of the trafficking of its binding partners at specific subcellular location in neurons.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"EphrinB ligands recruit GRIP family PDZ adaptor proteins into raft membrane microdomains."_x005F_x005F_x000D_Brueckner K., Pablo Labrador J., Scheiffele P., Herb A., Seeburg P.H., Klein R._x005F_x005F_x000D_Neuron 22:511-524(1999) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] OF 265-1128 (ISOFORM 2), FUNCTION, INTERACTION WITH EFNB1 AND EFNB3, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL

GRIP1 Rabbit Polyclonal Antibody