GRIP1 Rabbit Polyclonal Antibody

GRIP1 Rabbit Polyclonal Antibody

GRIP1 Polyclonal Antibody
ES10692-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GRIP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GRIP1 Polyclonal Antibody
ES10692-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GRIP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GRIP1 Rabbit pAb
A5747-100ul 100 ul
EUR 308

GRIP1 Rabbit pAb
A5747-200ul 200 ul
EUR 459

GRIP1 Rabbit pAb
A5747-20ul 20 ul
EUR 183

GRIP1 Rabbit pAb
A5747-50ul 50 ul
EUR 223

GRIP1 Rabbit pAb
A16503-100ul 100 ul
EUR 308

GRIP1 Rabbit pAb
A16503-200ul 200 ul
EUR 459

GRIP1 Rabbit pAb
A16503-20ul 20 ul
EUR 183

GRIP1 Rabbit pAb
A16503-50ul 50 ul
EUR 223

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-48T 48T
EUR 498
  • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-96T 96T
EUR 647
  • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-48Tests 48 Tests
EUR 522

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-96Tests 96 Tests
EUR 724

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-48Tests 48 Tests
EUR 500

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-96Tests 96 Tests
EUR 692

GRIP1 antibody
20R-1077 100 ug
EUR 377
Description: Rabbit polyclonal GRIP1 antibody

GRIP1 Antibody
44803-100ul 100ul
EUR 252

GRIP1 Antibody
44803-50ul 50ul
EUR 187

GRIP1 Antibody
DF2500 200ul
EUR 304
Description: GRIP1 antibody detects endogenous levels of total GRIP1.

GRIP1 antibody
70R-7931 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GRIP1 antibody

GRIP1 Antibody
ABD2500 100 ug
EUR 438

Polyclonal GRIP1 antibody - C-terminal region
APR12279G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRIP1 - C-terminal region. This antibody is tested and proven to work in the following applications:

GRIP1 Conjugated Antibody
C44803 100ul
EUR 397

anti- GRIP1 antibody
FNab03650 100µg
EUR 548.75
  • Immunogen: glutamate receptor interacting protein 1
  • Uniprot ID: Q9Y3R0
  • Gene ID: 23426
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against GRIP1

Anti-GRIP1 antibody
PAab03650 100 ug
EUR 386

Anti-GRIP1 antibody
STJ28314 100 µl
EUR 277
Description: This gene encodes a member of the glutamate receptor interacting protein family. The encoded scaffold protein binds to and mediates the trafficking and membrane organization of a number of transmembrane proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-GRIP1 antibody
STJ118942 100 µl
EUR 277

Anti-GRIP1 antibody
STJ191850 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GRIP1

Grip1/ Rat Grip1 ELISA Kit
ELI-42869r 96 Tests
EUR 886

GRIP1 siRNA
20-abx902326
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRIP1 siRNA
20-abx918710
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRIP1 siRNA
20-abx918711
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GRIP1
YF-PA25886 50 ul
EUR 334
Description: Mouse polyclonal to GRIP1

GRIP1 Blocking Peptide
33R-8113 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIP1 antibody, catalog no. 70R-7931

GRIP1 Blocking Peptide
33R-6108 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIP1 antibody, catalog no. 20R-1077

GRIP1 cloning plasmid
CSB-CL897486HU-10ug 10ug
EUR 1154
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3231
  • Sequence: ATGATAGCTGTCTCTTTTAAATGCCGTTGTCAAATTCTGAGGCGACTTACTAAAGATGAGAGTCCCTACACTAAATCCGCCAGCCAGACAAAGCCGCCTGATGGAGCGTTGGCTGTGAGGAGACAGAGCATCCCAGAGGAATTCAAGGGCTCCACAGTCGTCGAGCTGATGAAGA
  • Show more
Description: A cloning plasmid for the GRIP1 gene.

GRIP1 Blocking Peptide
DF2500-BP 1mg
EUR 195

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human)
4-PAB753Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1)

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human)
4-PAB753Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1)

GRIP1-Associated Protein 1 (GRASP1) Antibody
20-abx112850
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
20-abx125907
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
abx233651-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GRIP1-Associated Protein 1 (GRIPAP1) Antibody
abx332123-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
abx430720-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC
4-PAB753Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Biotinylated
4-PAB753Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Biotin.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Cy3
4-PAB753Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Cy3.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), FITC
4-PAB753Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with FITC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), HRP
4-PAB753Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with HRP.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), PE
4-PAB753Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with PE.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC
4-PAB753Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Biotinylated
4-PAB753Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Biotin.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Cy3
4-PAB753Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Cy3.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), FITC
4-PAB753Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with FITC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), HRP
4-PAB753Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with HRP.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), PE
4-PAB753Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with PE.

GRIP1 ELISA KIT|Human
EF009995 96 Tests
EUR 689

Mouse GRIP1 shRNA Plasmid
20-abx978072
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GRIP1 shRNA Plasmid
20-abx986893
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GRIP1 shRNA Plasmid
20-abx958262
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rabbit Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E04G0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E04G0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E04G0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB753Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC-Cy7.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB753Hu02-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC-Cy7.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx006798
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx104159
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx104160
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx132386
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
20-abx148365
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Antibody
abx233650-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-GRIP1 Associated Protein 1 (GRASP1) antibody
STJ120112 100 µl
EUR 526

Grip1 ORF Vector (Rat) (pORF)
ORF067898 1.0 ug DNA
EUR 506

GRIP1 ORF Vector (Human) (pORF)
ORF013216 1.0 ug DNA
EUR 354

Grip1 ORF Vector (Mouse) (pORF)
ORF046679 1.0 ug DNA
EUR 506

Grip1 ORF Vector (Mouse) (pORF)
ORF046680 1.0 ug DNA
EUR 506

Grip1 ORF Vector (Mouse) (pORF)
ORF046681 1.0 ug DNA
EUR 506

Grip1 sgRNA CRISPR Lentivector set (Rat)
K7012101 3 x 1.0 ug
EUR 339

GRIP1 Rabbit Polyclonal Antibody