ING3 Rabbit Polyclonal Antibody

ING3 Rabbit Polyclonal Antibody

ING3 Polyclonal Antibody

ES10794-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ING3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ING3 Rabbit pAb

A5832-100ul 100 ul
EUR 308

ING3 Rabbit pAb

A5832-200ul 200 ul
EUR 459

ING3 Rabbit pAb

A5832-20ul 20 ul
EUR 183

ING3 Rabbit pAb

A5832-50ul 50 ul
EUR 223

ING3 antibody

70R-17970 50 ul
EUR 435
Description: Rabbit polyclonal ING3 antibody

ING3 antibody

70R-2097 50 ug
EUR 467
Description: Rabbit polyclonal ING3 antibody raised against the N terminal of ING3

ING3 antibody

70R-3052 50 ug
EUR 467
Description: Rabbit polyclonal ING3 antibody raised against the middle region of ING3

ING3 Antibody

33074-100ul 100ul
EUR 252

ING3 Antibody

1-CSB-PA865171LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:2000-1:10000, IHC:1:20-1:200

ING3 Antibody

DF2637 200ul
EUR 304
Description: ING3 antibody detects endogenous levels of total ING3.

ING3 Antibody

DF8079 200ul
EUR 304
Description: ING3 Antibody detects endogenous levels of total ING3.

ING3 Antibody

1-CSB-PA011714GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

ING3 Antibody

ABD2637 100 ug
EUR 438

ING3 Antibody

ABD8079 100 ug
EUR 438

ING3 Conjugated Antibody

C33074 100ul
EUR 397

ING3-specific Antibody

abx234312-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

anti- ING3 antibody

FNab04311 100µg
EUR 548.75
  • Immunogen: inhibitor of growth family, member 3
  • Uniprot ID: Q9NXR8
  • Gene ID: 54556
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING3

Anti-ING3 antibody

PAab04311 100 ug
EUR 386

Anti-ING3 antibody

STJ28395 100 µl
EUR 277
Description: The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed.

Anti-ING3 antibody

STJ191952 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ING3

Ing3/ Rat Ing3 ELISA Kit

ELI-37703r 96 Tests
EUR 886

ING3 siRNA

20-abx902680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ING3 siRNA

20-abx920607
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ING3 siRNA

20-abx920608
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ING3

YF-PA26262 50 ul
EUR 334
Description: Mouse polyclonal to ING3

Anti-p47 ING3 Antibody

A05458 100ug
EUR 432
Description: Goat Polyclonal p47 ING3 Antibody. Validated in WB and tested in Human.

ING3 Antibody, HRP conjugated

1-CSB-PA865171LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ING3 Antibody, FITC conjugated

1-CSB-PA865171LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ING3 Antibody, Biotin conjugated

1-CSB-PA865171LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti- ING3-specific antibody

FNab04312 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2400
  • Immunogen: inhibitor of growth family, member 3
  • Uniprot ID: Q9NXR8
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING3-specific

Anti-ING3-specific antibody

PAab04312 100 ug
EUR 386

ING3 Blocking Peptide

33R-5453 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-3052

ING3 Blocking Peptide

33R-5862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-2097

ING3 Blocking Peptide

DF2637-BP 1mg
EUR 195

ING3 Blocking Peptide

DF8079-BP 1mg
EUR 195

ING3 cloning plasmid

CSB-CL865171HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 279
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.

ING3 cloning plasmid

CSB-CL865171HU2-10ug 10ug
EUR 194
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 300
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.

ING3 cloning plasmid

CSB-CL865171HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 282
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.

Anti-ING3 (2E9)

YF-MA18657 50 ug
EUR 363
Description: Mouse monoclonal to ING3

Anti-ING3 (2C4)

YF-MA18659 100 ug
EUR 363
Description: Mouse monoclonal to ING3

Anti-ING3 (2D8)

YF-MA18660 100 ug
EUR 363
Description: Mouse monoclonal to ING3

ING3 ELISA KIT|Human

EF010338 96 Tests
EUR 689

Rat ING3 shRNA Plasmid

20-abx989707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ING3 shRNA Plasmid

20-abx977509
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ING3 shRNA Plasmid

20-abx960134
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ING3 Recombinant Protein (Human)

RP016144 100 ug Ask for price

ING3 Recombinant Protein (Human)

RP016147 100 ug Ask for price

ING3 Recombinant Protein (Human)

RP016150 100 ug Ask for price

ING3 Recombinant Protein (Rat)

RP206024 100 ug Ask for price

ING3 Recombinant Protein (Mouse)

RP143831 100 ug Ask for price

ING3 Rabbit Polyclonal Antibody