ING3 Rabbit Polyclonal Antibody
ING3 Polyclonal Antibody |
ES10794-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ING3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ING3 Rabbit pAb |
A5832-100ul |
Abclonal |
100 ul |
EUR 308 |
ING3 Rabbit pAb |
A5832-200ul |
Abclonal |
200 ul |
EUR 459 |
ING3 Rabbit pAb |
A5832-20ul |
Abclonal |
20 ul |
EUR 183 |
ING3 Rabbit pAb |
A5832-50ul |
Abclonal |
50 ul |
EUR 223 |
ING3 antibody |
70R-17970 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ING3 antibody |
ING3 antibody |
70R-2097 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ING3 antibody raised against the N terminal of ING3 |
ING3 antibody |
70R-3052 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ING3 antibody raised against the middle region of ING3 |
ING3 Antibody |
33074-100ul |
SAB |
100ul |
EUR 252 |
ING3 Antibody |
1-CSB-PA865171LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:2000-1:10000, IHC:1:20-1:200 |
ING3 Antibody |
DF2637 |
Affbiotech |
200ul |
EUR 304 |
Description: ING3 antibody detects endogenous levels of total ING3. |
ING3 Antibody |
DF8079 |
Affbiotech |
200ul |
EUR 304 |
Description: ING3 Antibody detects endogenous levels of total ING3. |
ING3 Antibody |
1-CSB-PA011714GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
ING3 Conjugated Antibody |
C33074 |
SAB |
100ul |
EUR 397 |
ING3-specific Antibody |
abx234312-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
anti- ING3 antibody |
FNab04311 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: inhibitor of growth family, member 3
- Uniprot ID: Q9NXR8
- Gene ID: 54556
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against ING3 |
Anti-ING3 antibody |
STJ28395 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. |
Anti-ING3 antibody |
STJ191952 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ING3 |
ING3 siRNA |
20-abx902680 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ING3 siRNA |
20-abx920607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ING3 siRNA |
20-abx920608 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ING3 |
YF-PA26262 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to ING3 |
Anti-p47 ING3 Antibody |
A05458 |
BosterBio |
100ug |
EUR 432 |
Description: Goat Polyclonal p47 ING3 Antibody. Validated in WB and tested in Human. |
ING3 Antibody, HRP conjugated |
1-CSB-PA865171LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ING3 Antibody, FITC conjugated |
1-CSB-PA865171LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ING3 Antibody, Biotin conjugated |
1-CSB-PA865171LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
anti- ING3-specific antibody |
FNab04312 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2400
- Immunogen: inhibitor of growth family, member 3
- Uniprot ID: Q9NXR8
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against ING3-specific |
ING3 Blocking Peptide |
33R-5453 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-3052 |
ING3 Blocking Peptide |
33R-5862 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-2097 |
ING3 Blocking Peptide |
DF2637-BP |
Affbiotech |
1mg |
EUR 195 |
ING3 Blocking Peptide |
DF8079-BP |
Affbiotech |
1mg |
EUR 195 |
ING3 cloning plasmid |
CSB-CL865171HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 279
- Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
- Show more
|
Description: A cloning plasmid for the ING3 gene. |
ING3 cloning plasmid |
CSB-CL865171HU2-10ug |
Cusabio |
10ug |
EUR 194 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 300
- Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
- Show more
|
Description: A cloning plasmid for the ING3 gene. |
ING3 cloning plasmid |
CSB-CL865171HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 282
- Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
- Show more
|
Description: A cloning plasmid for the ING3 gene. |
Anti-ING3 (2E9) |
YF-MA18657 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to ING3 |
Anti-ING3 (2C4) |
YF-MA18659 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ING3 |
Anti-ING3 (2D8) |
YF-MA18660 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ING3 |
Rat ING3 shRNA Plasmid |
20-abx989707 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ING3 shRNA Plasmid |
20-abx977509 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ING3 shRNA Plasmid |
20-abx960134 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ING3 Recombinant Protein (Human) |
RP016144 |
ABM |
100 ug |
Ask for price |
ING3 Recombinant Protein (Human) |
RP016147 |
ABM |
100 ug |
Ask for price |
ING3 Recombinant Protein (Human) |
RP016150 |
ABM |
100 ug |
Ask for price |
ING3 Recombinant Protein (Rat) |
RP206024 |
ABM |
100 ug |
Ask for price |
ING3 Recombinant Protein (Mouse) |
RP143831 |
ABM |
100 ug |
Ask for price |
ING3 Rabbit Polyclonal Antibody