ING5 Rabbit Polyclonal Antibody
ING5 Polyclonal Antibody |
ABP58940-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ING5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ING5 from Human, Mouse. This ING5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING5 protein |
ING5 Polyclonal Antibody |
ABP58940-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ING5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ING5 from Human, Mouse. This ING5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING5 protein |
ING5 Rabbit pAb |
A7288-100ul |
Abclonal |
100 ul |
EUR 308 |
ING5 Rabbit pAb |
A7288-200ul |
Abclonal |
200 ul |
EUR 459 |
ING5 Rabbit pAb |
A7288-20ul |
Abclonal |
20 ul |
EUR 183 |
ING5 Rabbit pAb |
A7288-50ul |
Abclonal |
50 ul |
EUR 223 |
ING5 antibody |
70R-9066 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ING5 antibody |
ING5 Antibody |
43390-100ul |
SAB |
100ul |
EUR 252 |
ING5 antibody |
22644-100ul |
SAB |
100ul |
EUR 390 |
ING5 antibody |
70R-17972 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ING5 antibody |
ING5 antibody |
70R-12671 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal ING5 antibody |
ING5 Antibody |
DF2634 |
Affbiotech |
200ul |
EUR 304 |
Description: ING5 antibody detects endogenous levels of total ING5. |
ING5 Antibody |
1-CSB-PA011716GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
ING5 Antibody |
1-CSB-PA820185LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
ING5 Conjugated Antibody |
C43390 |
SAB |
100ul |
EUR 397 |
anti- ING5 antibody |
FNab04315 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: inhibitor of growth family, member 5
- Uniprot ID: Q8WYH8
- Gene ID: 84289
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against ING5 |
Anti-ING5 antibody |
STJ29427 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a tumor suppressor protein that inhibits cell growth and induces apoptosis. This protein contains a PHD-type zinc finger. It interacts with tumor suppressor p53 and p300, a component of the histone acetyl transferase complex, suggesting a role in transcriptional regulation. Alternative splicing and the use of multiple promoters and 3' ends results in multiple transcript variants. |
Anti-ING5 antibody |
STJ191950 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ING5 |
ING5 siRNA |
20-abx920611 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ING5 siRNA |
20-abx920612 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ING5 |
YF-PA21371 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ING5 |
anti-ING5 |
YF-PA26721 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to ING5 |
Anti-p28 ING5 Antibody |
A04974 |
BosterBio |
100ug |
EUR 432 |
Description: Goat Polyclonal p28 ING5 Antibody. Validated in WB and tested in Human. |
ING5 Antibody, HRP conjugated |
1-CSB-PA820185LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ING5 Antibody, FITC conjugated |
1-CSB-PA820185LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ING5 Antibody, Biotin conjugated |
1-CSB-PA820185LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ING5 Blocking Peptide |
33R-8664 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING5 antibody, catalog no. 70R-9066 |
ING5 Blocking Peptide |
DF2634-BP |
Affbiotech |
1mg |
EUR 195 |
ING5 cloning plasmid |
CSB-CL820185HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 681
- Sequence: atggcgaccgccatgtacttggagcactatctggacagtatcgagaaccttccctgcgaacttcagaggaacttccagctgatgcgagagctggaccagaggacggaagataagaaagcagagattgacatcctggctgcagagtacatctccacggtgaagacgctgtctccaga
- Show more
|
Description: A cloning plasmid for the ING5 gene. |
ING5 cloning plasmid |
CSB-CL820185HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 723
- Sequence: atggcgaccgccatgtacttggagcactatctggacagtatcgagaaccttccctgcgaacttcagaggaacttccagctgatgcgagagctggaccagaggacggaagataagaaagcagagattgacatcctggctgcagagtacatctccacggtgaagacgctgtctccaga
- Show more
|
Description: A cloning plasmid for the ING5 gene. |
Mouse ING5 shRNA Plasmid |
20-abx975508 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ING5 shRNA Plasmid |
20-abx963413 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ING5 Recombinant Protein (Human) |
RP016156 |
ABM |
100 ug |
Ask for price |
ING5 Recombinant Protein (Human) |
RP016159 |
ABM |
100 ug |
Ask for price |
ING5 Recombinant Protein (Rat) |
RP206030 |
ABM |
100 ug |
Ask for price |
ING5 Recombinant Protein (Mouse) |
RP143837 |
ABM |
100 ug |
Ask for price |
Inhibitor of Growth Protein 5 (ING5) Antibody |
20-abx113136 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 5 (ING5) Antibody |
abx034391-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 5 (ING5) Antibody |
abx034391-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 5 (ING5) Antibody |
20-abx005495 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 5 (ING5) Antibody |
abx234315-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Inhibitor of Growth Protein 5 (ING5) Antibody |
20-abx301083 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 5 (ING5) Antibody |
20-abx225250 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
ING5 Rabbit Polyclonal Antibody