ING5 Rabbit Polyclonal Antibody

ING5 Rabbit Polyclonal Antibody

ING5 Polyclonal Antibody

ES10792-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ING5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ING5 Polyclonal Antibody

ES10792-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ING5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ING5 Rabbit pAb

A7288-100ul 100 ul
EUR 308

ING5 Rabbit pAb

A7288-200ul 200 ul
EUR 459

ING5 Rabbit pAb

A7288-20ul 20 ul
EUR 183

ING5 Rabbit pAb

A7288-50ul 50 ul
EUR 223

ING5 antibody

22644-100ul 100ul
EUR 390

ING5 antibody

70R-17972 50 ul
EUR 435
Description: Rabbit polyclonal ING5 antibody

ING5 antibody

70R-12671 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal ING5 antibody

ING5 Antibody

43390-100ul 100ul
EUR 252

ING5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

ING5 Antibody

DF2634 200ul
EUR 304
Description: ING5 antibody detects endogenous levels of total ING5.

ING5 antibody

70R-9066 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ING5 antibody

ING5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ING5 Antibody

ABD13124 100 ug
EUR 438

ING5 Antibody

ABD2634 100 ug
EUR 438

ING5 Conjugated Antibody

C43390 100ul
EUR 397

anti- ING5 antibody

FNab04315 100µg
EUR 548.75
  • Immunogen: inhibitor of growth family, member 5
  • Uniprot ID: Q8WYH8
  • Gene ID: 84289
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING5

Anti-ING5 antibody

PAab04315 100 ug
EUR 386

Anti-ING5 antibody

STJ29427 100 µl
EUR 277
Description: This gene encodes a tumor suppressor protein that inhibits cell growth and induces apoptosis. This protein contains a PHD-type zinc finger. It interacts with tumor suppressor p53 and p300, a component of the histone acetyl transferase complex, suggesting a role in transcriptional regulation. Alternative splicing and the use of multiple promoters and 3' ends results in multiple transcript variants.

Anti-ING5 antibody

STJ191950 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ING5


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- ING5

PVT11502 2 ug
EUR 273


YF-PA21371 50 ug
EUR 363
Description: Mouse polyclonal to ING5


YF-PA26721 50 ul
EUR 334
Description: Mouse polyclonal to ING5

Anti-p28 ING5 Antibody

A04974 100ug
EUR 432
Description: Goat Polyclonal p28 ING5 Antibody. Validated in WB and tested in Human.

ING5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ING5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ING5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING5. Recognizes ING5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ING5 Blocking Peptide

33R-8664 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING5 antibody, catalog no. 70R-9066

ING5 Blocking Peptide

DF2634-BP 1mg
EUR 195

ING5 cloning plasmid

CSB-CL820185HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atggcgaccgccatgtacttggagcactatctggacagtatcgagaaccttccctgcgaacttcagaggaacttccagctgatgcgagagctggaccagaggacggaagataagaaagcagagattgacatcctggctgcagagtacatctccacggtgaagacgctgtctccaga
  • Show more
Description: A cloning plasmid for the ING5 gene.

ING5 cloning plasmid

CSB-CL820185HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: atggcgaccgccatgtacttggagcactatctggacagtatcgagaaccttccctgcgaacttcagaggaacttccagctgatgcgagagctggaccagaggacggaagataagaaagcagagattgacatcctggctgcagagtacatctccacggtgaagacgctgtctccaga
  • Show more
Description: A cloning plasmid for the ING5 gene.


EF010340 96 Tests
EUR 689

Mouse ING5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ING5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT13348 2 ug
EUR 599

ING5 Recombinant Protein (Human)

RP016156 100 ug Ask for price

ING5 Recombinant Protein (Human)

RP016159 100 ug Ask for price

ING5 Recombinant Protein (Rat)

RP206030 100 ug Ask for price

ING5 Recombinant Protein (Mouse)

RP143837 100 ug Ask for price

Inhibitor of Growth Protein 5 (ING5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 5 (ING5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 5 (ING5) Antibody

abx034391-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 5 (ING5) Antibody

abx034391-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 5 (ING5) Antibody

abx234315-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Inhibitor of Growth Protein 5 (ING5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 5 (ING5) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ING5 Rabbit Polyclonal Antibody