LRRK2 Rabbit Polyclonal Antibody

LRRK2 Rabbit Polyclonal Antibody

LRRK2 Polyclonal Antibody

ABP59149-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LRRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LRRK2 from Human, Mouse. This LRRK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRK2 protein

LRRK2 Polyclonal Antibody

ABP59149-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LRRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LRRK2 from Human, Mouse. This LRRK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRK2 protein

LRRK2 Polyclonal Antibody

ES10815-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LRRK2 from Human/Mouse. This antibody is tested and validated for IHC

LRRK2 Polyclonal Antibody

ES10815-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LRRK2 from Human/Mouse. This antibody is tested and validated for IHC

LRRK2 Rabbit pAb

A0859-100ul 100 ul
EUR 308

LRRK2 Rabbit pAb

A0859-200ul 200 ul
EUR 459

LRRK2 Rabbit pAb

A0859-20ul 20 ul
EUR 183

LRRK2 Rabbit pAb

A0859-50ul 50 ul
EUR 223

LRRK2 Rabbit pAb

A10959-100ul 100 ul
EUR 308

LRRK2 Rabbit pAb

A10959-200ul 200 ul
EUR 459

LRRK2 Rabbit pAb

A10959-20ul 20 ul Ask for price

LRRK2 Rabbit pAb

A10959-50ul 50 ul Ask for price

LRRK2 Rabbit pAb

A17253-100ul 100 ul
EUR 308

LRRK2 Rabbit pAb

A17253-200ul 200 ul
EUR 459

LRRK2 Rabbit pAb

A17253-20ul 20 ul
EUR 183

LRRK2 Rabbit pAb

A17253-50ul 50 ul
EUR 223

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

DLR-LRRK2-Hu-48T 48T
EUR 517
  • Should the Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leucine Rich Repeat Kinase 2 (LRRK2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

DLR-LRRK2-Hu-96T 96T
EUR 673
  • Should the Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leucine Rich Repeat Kinase 2 (LRRK2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RDR-LRRK2-Hu-48Tests 48 Tests
EUR 544

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RDR-LRRK2-Hu-96Tests 96 Tests
EUR 756

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RD-LRRK2-Hu-48Tests 48 Tests
EUR 521

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RD-LRRK2-Hu-96Tests 96 Tests
EUR 723

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Polyclonal PARK8 (LRRK2) Antibody (L955)

APG03034G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L955). This antibody is tested and proven to work in the following applications:

Polyclonal PARK8 (LRRK2) Antibody (E519)

APR11282G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (E519). This antibody is tested and proven to work in the following applications:

Polyclonal PARK8 (LRRK2) Antibody (L893)

APR11283G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L893). This antibody is tested and proven to work in the following applications:

Polyclonal PARK8 (LRRK2) Antibody (L899)

APR11284G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L899). This antibody is tested and proven to work in the following applications:

Polyclonal LRRK2 Antibody (C-Terminus)

APR12471G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRRK2 (C-Terminus). This antibody is tested and proven to work in the following applications:

LRRK2 Antibody

35803-100ul 100ul
EUR 252

LRRK2 Antibody

1-CSB-PA902150
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

LRRK2 Antibody

1-CSB-PA722493LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

LRRK2 Antibody

DF2668 200ul
EUR 304
Description: LRRK2 antibody detects endogenous levels of total LRRK2.

LRRK2 Antibody

1-CSB-PA444926
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

LRRK2 Antibody

ABD2668 100 ug
EUR 438

LRRK2 Conjugated Antibody

C35803 100ul
EUR 397

Anti-LRRK2 Antibody

PB9281 100ug/vial
EUR 294

Anti-LRRK2 antibody

STJ112849 100 µl
EUR 277
Description: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.

Anti-LRRK2 antibody

STJ117999 100 µl
EUR 277

Anti-LRRK2 antibody

STJ119412 100 µl
EUR 277

Anti-LRRK2 antibody

STJ191973 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LRRK2

Anti-Phospho-LRRK2 (S935) Rabbit Monoclonal Antibody

P00221 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-LRRK2 (S935) Antibody. Validated in IF, WB and tested in Human, Mouse.

anti-LRRK2

YF-PA26847 50 ul
EUR 334
Description: Mouse polyclonal to LRRK2

LRRK2 Antibody, HRP conjugated

1-CSB-PA722493LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LRRK2 Antibody, FITC conjugated

1-CSB-PA722493LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LRRK2 Antibody, Biotin conjugated

1-CSB-PA722493LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LRRK2 Blocking Peptide

DF2668-BP 1mg
EUR 195

LRRK2 cloning plasmid

CSB-CL722493HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 7584
  • Sequence: atggctagtggcagctgtcaggggtgcgaagaggacgaggaaactctgaagaagttgatagtcaggctgaacaatgtccaggaaggaaaacagatagaaacgctggtccaaatcctggaggatctgctggtgttcacgtactccgagcacgcctccaagttatttcaaggcaaaa
  • Show more
Description: A cloning plasmid for the LRRK2 gene.

LRRK2-IN-1

A3558-10 10 mg
EUR 148
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

A3558-100 100 mg
EUR 595
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

A3558-5.1 10 mM (in 1mL DMSO)
EUR 197
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

A3558-50 50 mg
EUR 421
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

HY-10875 100mg
EUR 1083

LRRK2 inhibitor 1

HY-111493 50mg
EUR 2633

pDEST51- LRRK2- R1441G

PVT10304 2 ug
EUR 370

2XMyc-LRRK2-WT

PVT14586 2 ug
EUR 599

Anti-LRRK2 (3B2)

YF-MA11738 100 ug
EUR 363
Description: Mouse monoclonal to LRRK2

Monoclonal antibody for LRRK2/Dardarin

SMC-445D 0.1mg
EUR 353
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is not conjugated.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A390 0.1mg
EUR 400
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 390.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A488 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 488.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A565 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 565.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A594 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 594.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A633 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 633.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A655 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 655.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A680 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 680.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A700 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 700.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-ALP 0.1mg
EUR 393
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Alkaline Phosphatase.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-APC 0.1mg
EUR 398
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with APC.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-APCCY7 0.1mg
EUR 470
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with APC/Cy7.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-BI 0.1mg
EUR 395
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Biotin.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-DY350 0.1mg
EUR 413
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 350.

LRRK2 Rabbit Polyclonal Antibody