MATN3 Rabbit Polyclonal Antibody

MATN3 Rabbit Polyclonal Antibody

MATN3 Polyclonal Antibody

ES10890-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MATN3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MATN3 Polyclonal Antibody

ABP59228-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MATN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATN3 from Human, Mouse. This MATN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN3 protein

MATN3 Polyclonal Antibody

ABP59228-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MATN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATN3 from Human, Mouse. This MATN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN3 protein

MATN3 Polyclonal Antibody

ABP59228-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MATN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATN3 from Human, Mouse. This MATN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN3 protein

MATN3 Rabbit pAb

A15072-100ul 100 ul
EUR 308

MATN3 Rabbit pAb

A15072-200ul 200 ul
EUR 459

MATN3 Rabbit pAb

A15072-20ul 20 ul
EUR 183

MATN3 Rabbit pAb

A15072-50ul 50 ul
EUR 223

MATN3 Rabbit pAb

A7700-100ul 100 ul
EUR 308

MATN3 Rabbit pAb

A7700-200ul 200 ul
EUR 459

MATN3 Rabbit pAb

A7700-20ul 20 ul
EUR 183

MATN3 Rabbit pAb

A7700-50ul 50 ul
EUR 223

MATN3 Antibody

35809-100ul 100ul
EUR 252

MATN3 Antibody

24876-100ul 100ul
EUR 390

MATN3 Antibody

24882-100ul 100ul
EUR 390

MATN3 Antibody

1-CSB-PA013522EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

MATN3 Antibody

1-CSB-PA013522ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MATN3 Antibody

1-CSB-PA013522ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

MATN3 Antibody

1-CSB-PA044893
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

MATN3 Conjugated Antibody

C35809 100ul
EUR 397

Anti-MATN3 antibody

STJ110013 100 µl
EUR 277
Description: This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia.

Anti-MATN3 antibody

STJ117266 100 µl
EUR 277
Description: This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia.

Anti-MATN3 antibody

STJ192048 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MATN3

MATN3 siRNA

20-abx923624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MATN3 siRNA

20-abx923625
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Matrilin 3 (MATN3) Antibody

abx145456-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Matrilin 3 (MATN3) Antibody

20-abx006513
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrilin 3 (MATN3) Antibody

20-abx320560
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrilin 3 (MATN3) Antibody

20-abx322187
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrilin 3 (MATN3) Antibody

20-abx212167
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrilin 3 (MATN3) Antibody

20-abx225283
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

MATN3 Antibody, HRP conjugated

1-CSB-PA013522EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MATN3 Antibody, FITC conjugated

1-CSB-PA013522EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MATN3 Antibody, Biotin conjugated

1-CSB-PA013522ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MATN3 cloning plasmid

CSB-CL013522HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1461
  • Sequence: ATGCCGCGCCCGGCCCCCGCGCGCCGCCTCCCGGGACTCCTCCTGCTGCTCTGGCCGCTGCTGCTGCTGCCCTCCGCCGCCCCCGACCCCGTGGCCCGCCCGGGCTTCCGGAGGCTGGAGACCCGAGGTCCCGGGGGCAGCCCTGGACGCCGCCCCTCTCCTGCGGCTCCCGACG
  • Show more
Description: A cloning plasmid for the MATN3 gene.

pCMV-SPORT6-MATN3

PVT14346 2 ug
EUR 495

Anti-Matrilin 3/MATN3 Antibody

PA1927 100ug/vial
EUR 294

Human MATN3 shRNA Plasmid

20-abx952821
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MATN3 shRNA Plasmid

20-abx971443
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MATN3 Recombinant Protein (Human)

RP041257 100 ug Ask for price

MATN3 Recombinant Protein (Rat)

RP210962 100 ug Ask for price

MATN3 Recombinant Protein (Mouse)

RP149585 100 ug Ask for price

Matn3 ORF Vector (Mouse) (pORF)

ORF049863 1.0 ug DNA
EUR 506

MATN3 ORF Vector (Human) (pORF)

ORF013753 1.0 ug DNA
EUR 354

Matn3 ORF Vector (Rat) (pORF)

ORF070322 1.0 ug DNA
EUR 506

Human Matrilin- 3, MATN3 ELISA KIT

ELI-19574h 96 Tests
EUR 824

Mouse Matrilin- 3, Matn3 ELISA KIT

ELI-19575m 96 Tests
EUR 865

Chicken Matrilin- 3, MATN3 ELISA KIT

ELI-23709c 96 Tests
EUR 928

MATN3 sgRNA CRISPR Lentivector set (Human)

K1273301 3 x 1.0 ug
EUR 339

Matn3 sgRNA CRISPR Lentivector set (Mouse)

K3813701 3 x 1.0 ug
EUR 339

Matn3 sgRNA CRISPR Lentivector set (Rat)

K6713901 3 x 1.0 ug
EUR 339

Human Matrilin 3(MATN3)ELISA Kit

QY-E02133 96T
EUR 361

MATN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1273302 1.0 ug DNA
EUR 154

MATN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1273303 1.0 ug DNA
EUR 154

MATN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1273304 1.0 ug DNA
EUR 154

Matn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3813702 1.0 ug DNA
EUR 154

Matn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3813703 1.0 ug DNA
EUR 154

Matn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3813704 1.0 ug DNA
EUR 154

ELISA kit for Chicken Matrilin-3 (MATN3)

KTE30122-48T 48T
EUR 354
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Matrilin-3 (MATN3)

KTE30122-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Matrilin-3 (MATN3)

KTE30122-96T 96T
EUR 572
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Matn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6713902 1.0 ug DNA
EUR 154

Matn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6713903 1.0 ug DNA
EUR 154

Matn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6713904 1.0 ug DNA
EUR 154

ELISA kit for Human Matrilin-3 (MATN3)

KTE61710-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-3 (MATN3)

KTE61710-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrilin-3 (MATN3)

KTE61710-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-3 (MATN3)

KTE71112-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-3 (MATN3)

KTE71112-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrilin-3 (MATN3)

KTE71112-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MATN3 Protein Vector (Human) (pPB-C-His)

PV055009 500 ng
EUR 481

MATN3 Protein Vector (Human) (pPB-N-His)

PV055010 500 ng
EUR 481

MATN3 Protein Vector (Human) (pPM-C-HA)

PV055011 500 ng
EUR 481

MATN3 Protein Vector (Human) (pPM-C-His)

PV055012 500 ng
EUR 481

MATN3 Protein Vector (Rat) (pPB-C-His)

PV281286 500 ng
EUR 603

MATN3 Protein Vector (Rat) (pPB-N-His)

PV281287 500 ng
EUR 603

MATN3 Protein Vector (Rat) (pPM-C-HA)

PV281288 500 ng
EUR 603

MATN3 Protein Vector (Rat) (pPM-C-His)

PV281289 500 ng
EUR 603

MATN3 Protein Vector (Mouse) (pPB-C-His)

PV199450 500 ng
EUR 603

MATN3 Protein Vector (Mouse) (pPB-N-His)

PV199451 500 ng
EUR 603

MATN3 Protein Vector (Mouse) (pPM-C-HA)

PV199452 500 ng
EUR 603

MATN3 Protein Vector (Mouse) (pPM-C-His)

PV199453 500 ng
EUR 603

Matn3 3'UTR GFP Stable Cell Line

TU162944 1.0 ml Ask for price

Matn3 3'UTR Luciferase Stable Cell Line

TU212910 1.0 ml Ask for price

MATN3 3'UTR Luciferase Stable Cell Line

TU013052 1.0 ml
EUR 1394

Matn3 3'UTR Luciferase Stable Cell Line

TU112944 1.0 ml Ask for price

MATN3 3'UTR GFP Stable Cell Line

TU063052 1.0 ml
EUR 1394

Matn3 3'UTR GFP Stable Cell Line

TU262910 1.0 ml Ask for price

MATN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV649657 1.0 ug DNA
EUR 682

MATN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV649661 1.0 ug DNA
EUR 682

MATN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV649662 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MATN3 Rabbit Polyclonal Antibody