MATN3 Rabbit Polyclonal Antibody
MATN3 Polyclonal Antibody |
ES10890-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MATN3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MATN3 Polyclonal Antibody |
ABP59228-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MATN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MATN3 from Human, Mouse. This MATN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN3 protein |
MATN3 Polyclonal Antibody |
ABP59228-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MATN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MATN3 from Human, Mouse. This MATN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN3 protein |
MATN3 Polyclonal Antibody |
ABP59228-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MATN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MATN3 from Human, Mouse. This MATN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATN3 protein |
MATN3 Rabbit pAb |
A15072-100ul |
Abclonal |
100 ul |
EUR 308 |
MATN3 Rabbit pAb |
A15072-200ul |
Abclonal |
200 ul |
EUR 459 |
MATN3 Rabbit pAb |
A15072-20ul |
Abclonal |
20 ul |
EUR 183 |
MATN3 Rabbit pAb |
A15072-50ul |
Abclonal |
50 ul |
EUR 223 |
MATN3 Rabbit pAb |
A7700-100ul |
Abclonal |
100 ul |
EUR 308 |
MATN3 Rabbit pAb |
A7700-200ul |
Abclonal |
200 ul |
EUR 459 |
MATN3 Rabbit pAb |
A7700-20ul |
Abclonal |
20 ul |
EUR 183 |
MATN3 Rabbit pAb |
A7700-50ul |
Abclonal |
50 ul |
EUR 223 |
MATN3 Antibody |
35809-100ul |
SAB |
100ul |
EUR 252 |
MATN3 Antibody |
24876-100ul |
SAB |
100ul |
EUR 390 |
MATN3 Antibody |
24882-100ul |
SAB |
100ul |
EUR 390 |
MATN3 Antibody |
1-CSB-PA013522EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
MATN3 Antibody |
1-CSB-PA013522ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
MATN3 Antibody |
1-CSB-PA013522ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
MATN3 Antibody |
1-CSB-PA044893 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
MATN3 Conjugated Antibody |
C35809 |
SAB |
100ul |
EUR 397 |
Anti-MATN3 antibody |
STJ110013 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. |
Anti-MATN3 antibody |
STJ117266 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. |
Anti-MATN3 antibody |
STJ192048 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MATN3 |
MATN3 siRNA |
20-abx923624 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATN3 siRNA |
20-abx923625 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 3 (MATN3) Antibody |
abx145456-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Matrilin 3 (MATN3) Antibody |
20-abx006513 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Matrilin 3 (MATN3) Antibody |
20-abx320560 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 3 (MATN3) Antibody |
20-abx322187 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 3 (MATN3) Antibody |
20-abx212167 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrilin 3 (MATN3) Antibody |
20-abx225283 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
MATN3 Antibody, HRP conjugated |
1-CSB-PA013522EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MATN3 Antibody, FITC conjugated |
1-CSB-PA013522EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MATN3 Antibody, Biotin conjugated |
1-CSB-PA013522ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MATN3. Recognizes MATN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MATN3 cloning plasmid |
CSB-CL013522HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1461
- Sequence: ATGCCGCGCCCGGCCCCCGCGCGCCGCCTCCCGGGACTCCTCCTGCTGCTCTGGCCGCTGCTGCTGCTGCCCTCCGCCGCCCCCGACCCCGTGGCCCGCCCGGGCTTCCGGAGGCTGGAGACCCGAGGTCCCGGGGGCAGCCCTGGACGCCGCCCCTCTCCTGCGGCTCCCGACG
- Show more
|
Description: A cloning plasmid for the MATN3 gene. |
Anti-Matrilin 3/MATN3 Antibody |
PA1927 |
BosterBio |
100ug/vial |
EUR 294 |
Human MATN3 shRNA Plasmid |
20-abx952821 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MATN3 shRNA Plasmid |
20-abx971443 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MATN3 Recombinant Protein (Human) |
RP041257 |
ABM |
100 ug |
Ask for price |
MATN3 Recombinant Protein (Rat) |
RP210962 |
ABM |
100 ug |
Ask for price |
MATN3 Recombinant Protein (Mouse) |
RP149585 |
ABM |
100 ug |
Ask for price |
Matn3 ORF Vector (Mouse) (pORF) |
ORF049863 |
ABM |
1.0 ug DNA |
EUR 506 |
MATN3 ORF Vector (Human) (pORF) |
ORF013753 |
ABM |
1.0 ug DNA |
EUR 354 |
Matn3 ORF Vector (Rat) (pORF) |
ORF070322 |
ABM |
1.0 ug DNA |
EUR 506 |
MATN3 ELISA Kit (Human) (OKBB01391) |
OKBB01391 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Matrilin-3 is a protein that in humans is encoded by the MATN3 gene. This gene is mapped to 2p24.1. This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
Matn3 ELISA Kit (Mouse) (OKBB01392) |
OKBB01392 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Matrilin-3 is a protein that in humans is encoded by the MATN3 gene. This gene is mapped to 12 A1.1; 12 3.96 cM. This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
Matn3 ELISA Kit (Rat) (OKBB01393) |
OKBB01393 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Matrilin-3 is a protein that in humans is encoded by the MATN3 gene. This gene is mapped to 6q14. This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
MATN3 sgRNA CRISPR Lentivector set (Human) |
K1273301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Matn3 sgRNA CRISPR Lentivector set (Mouse) |
K3813701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Matn3 sgRNA CRISPR Lentivector set (Rat) |
K6713901 |
ABM |
3 x 1.0 ug |
EUR 339 |
MATN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1273302 |
ABM |
1.0 ug DNA |
EUR 154 |
MATN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1273303 |
ABM |
1.0 ug DNA |
EUR 154 |
MATN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1273304 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3813702 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3813703 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3813704 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Chicken Matrilin-3 (MATN3) |
KTE30122-48T |
Abbkine |
48T |
EUR 354 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Matrilin-3 (MATN3) |
KTE30122-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Matrilin-3 (MATN3) |
KTE30122-96T |
Abbkine |
96T |
EUR 572 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Matn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6713902 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6713903 |
ABM |
1.0 ug DNA |
EUR 154 |
Matn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6713904 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Matrilin-3 (MATN3) |
KTE61710-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-3 (MATN3) |
KTE61710-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrilin-3 (MATN3) |
KTE61710-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-3 (MATN3) |
KTE71112-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-3 (MATN3) |
KTE71112-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrilin-3 (MATN3) |
KTE71112-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrilin-3 (MATN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
MATN3 Protein Vector (Human) (pPB-C-His) |
PV055009 |
ABM |
500 ng |
EUR 481 |
MATN3 Protein Vector (Human) (pPB-N-His) |
PV055010 |
ABM |
500 ng |
EUR 481 |
MATN3 Protein Vector (Human) (pPM-C-HA) |
PV055011 |
ABM |
500 ng |
EUR 481 |
MATN3 Protein Vector (Human) (pPM-C-His) |
PV055012 |
ABM |
500 ng |
EUR 481 |
MATN3 Protein Vector (Rat) (pPB-C-His) |
PV281286 |
ABM |
500 ng |
EUR 603 |
MATN3 Protein Vector (Rat) (pPB-N-His) |
PV281287 |
ABM |
500 ng |
EUR 603 |
MATN3 Protein Vector (Rat) (pPM-C-HA) |
PV281288 |
ABM |
500 ng |
EUR 603 |
MATN3 Protein Vector (Rat) (pPM-C-His) |
PV281289 |
ABM |
500 ng |
EUR 603 |
MATN3 Protein Vector (Mouse) (pPB-C-His) |
PV199450 |
ABM |
500 ng |
EUR 603 |
MATN3 Protein Vector (Mouse) (pPB-N-His) |
PV199451 |
ABM |
500 ng |
EUR 603 |
MATN3 Protein Vector (Mouse) (pPM-C-HA) |
PV199452 |
ABM |
500 ng |
EUR 603 |
MATN3 Protein Vector (Mouse) (pPM-C-His) |
PV199453 |
ABM |
500 ng |
EUR 603 |
Matn3 3'UTR GFP Stable Cell Line |
TU162944 |
ABM |
1.0 ml |
Ask for price |
Matn3 3'UTR Luciferase Stable Cell Line |
TU212910 |
ABM |
1.0 ml |
Ask for price |
MATN3 3'UTR Luciferase Stable Cell Line |
TU013052 |
ABM |
1.0 ml |
EUR 1394 |
Matn3 3'UTR Luciferase Stable Cell Line |
TU112944 |
ABM |
1.0 ml |
Ask for price |
MATN3 3'UTR GFP Stable Cell Line |
TU063052 |
ABM |
1.0 ml |
EUR 1394 |
Matn3 3'UTR GFP Stable Cell Line |
TU262910 |
ABM |
1.0 ml |
Ask for price |
MATN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV649657 |
ABM |
1.0 ug DNA |
EUR 682 |
MATN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV649661 |
ABM |
1.0 ug DNA |
EUR 682 |
MATN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV649662 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MATN3 Rabbit Polyclonal Antibody