MINA Rabbit Polyclonal Antibody

MINA Rabbit Polyclonal Antibody

MINA Polyclonal Antibody

ABP59278-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MINA protein
  • Applications tips:
Description: A polyclonal antibody for detection of MINA from Human. This MINA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MINA protein

MINA Polyclonal Antibody

ABP59278-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MINA protein
  • Applications tips:
Description: A polyclonal antibody for detection of MINA from Human. This MINA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MINA protein

MINA Polyclonal Antibody

ABP59278-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MINA protein
  • Applications tips:
Description: A polyclonal antibody for detection of MINA from Human. This MINA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MINA protein

MINA Polyclonal Antibody

A66062 100 µg
EUR 570.55
Description: fast delivery possible

MINA Rabbit pAb

A6655-100ul 100 ul
EUR 308

MINA Rabbit pAb

A6655-200ul 200 ul
EUR 459

MINA Rabbit pAb

A6655-20ul 20 ul
EUR 183

MINA Rabbit pAb

A6655-50ul 50 ul
EUR 223

MINA antibody

70R-7820 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MINA antibody

MINA antibody

70R-8392 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MINA antibody

MINA Antibody

ABD13165 100 ug
EUR 438

MINA Antibody

ABD10071 100 ug
EUR 438

MINA antibody

39075-100ul 100ul
EUR 252

MINA Antibody

25060-100ul 100ul
EUR 390

MINA antibody

20R-1226 100 ug
EUR 377
Description: Rabbit polyclonal MINA antibody

MINA antibody

20R-1227 100 ug
EUR 377
Description: Rabbit polyclonal MINA antibody

MINA antibody

70R-18517 50 ul
EUR 435
Description: Rabbit polyclonal MINA antibody

MINA Antibody

DF10071 200ul
EUR 304
Description: MINA Antibody detects endogenous levels of total MINA.

MINA Antibody

1-CSB-PA013829GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MINA. Recognizes MINA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MINA Antibody

1-CSB-PA810267LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MINA. Recognizes MINA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MINA Polyclonal Antibody, HRP Conjugated

A66063 100 µg
EUR 570.55
Description: reagents widely cited

MINA Polyclonal Antibody, FITC Conjugated

A66064 100 µg
EUR 570.55
Description: Ask the seller for details

MINA Polyclonal Antibody, Biotin Conjugated

A66065 100 µg
EUR 570.55
Description: The best epigenetics products

MINA Conjugated Antibody

C39075 100ul
EUR 397

anti- MINA antibody

FNab05190 100µg
EUR 505.25
  • Immunogen: MYC induced nuclear antigen
  • Uniprot ID: Q8IUF8
  • Gene ID: 84864
  • Research Area: Metabolism
Description: Antibody raised against MINA

Anti-MINA antibody

PAab05190 100 ug
EUR 355

Anti-MINA antibody

STJ28738 100 µl
EUR 277

Anti-MINA antibody

STJ191782 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MINA

Mina/ Rat Mina ELISA Kit

ELI-23036r 96 Tests
EUR 886

MINA siRNA

20-abx903264
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MINA siRNA

20-abx924172
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MINA siRNA

20-abx924173
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MINA

YF-PA21499 50 ul
EUR 363
Description: Mouse polyclonal to MINA

anti-MINA

YF-PA21500 50 ug
EUR 363
Description: Mouse polyclonal to MINA

MINA Antibody, HRP conjugated

1-CSB-PA810267LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MINA. Recognizes MINA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MINA Antibody, FITC conjugated

1-CSB-PA810267LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MINA. Recognizes MINA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MINA Antibody, Biotin conjugated

1-CSB-PA810267LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MINA. Recognizes MINA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MINA Blocking Peptide

33R-3742 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MINA antibody, catalog no. 20R-1227

MINA Blocking Peptide

33R-6288 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MINA antibody, catalog no. 70R-8392

MINA Blocking Peptide

33R-6289 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MINA antibody, catalog no. 20R-1226

MINA Blocking Peptide

33R-6706 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MINA antibody, catalog no. 70R-7820

MINA Blocking Peptide

DF10071-BP 1mg
EUR 195

MINA cloning plasmid

CSB-CL810267HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atgccaaagaaagcaaagcctacagggagtgggaaggaagaggggccggctccctgtaagcagatgaagttagaagcagctggggggccttcagctttaaactttgacagtcccagtagtctctttgaaagtttaatctcgcccatcaagacagagacttttttcaaggaattct
  • Show more
Description: A cloning plasmid for the MINA gene.

pCMV-SPORT6-MINA

PVT13268 2 ug
EUR 391

Mouse MINA shRNA Plasmid

20-abx975919
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MINA shRNA Plasmid

20-abx988083
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MINA shRNA Plasmid

20-abx963646
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MINA ELISA KIT|Human

EF000796 96 Tests
EUR 689

MINA protein (His tag)

80R-3935 20 ug
EUR 327
Description: Purified recombinant MINA protein (His tag)

MINA Recombinant Protein (Human)

RP019486 100 ug Ask for price

MINA Recombinant Protein (Rat)

RP211778 100 ug Ask for price

MINA Recombinant Protein (Mouse)

RP150680 100 ug Ask for price

MYC Induced Nuclear Antigen (MINA) Antibody

abx235190-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MINA ORF Vector (Human) (pORF)

ORF006496 1.0 ug DNA
EUR 95

Mina ORF Vector (Mouse) (pORF)

ORF050228 1.0 ug DNA
EUR 506

Mina ORF Vector (Rat) (pORF)

ORF070594 1.0 ug DNA
EUR 506

MINA sgRNA CRISPR Lentivector set (Human)

K1303501 3 x 1.0 ug
EUR 339

Mina sgRNA CRISPR Lentivector set (Mouse)

K3553901 3 x 1.0 ug
EUR 339

Mina sgRNA CRISPR Lentivector set (Rat)

K7143601 3 x 1.0 ug
EUR 339

MINA sgRNA CRISPR Lentivector (Human) (Target 1)

K1303502 1.0 ug DNA
EUR 154

MINA sgRNA CRISPR Lentivector (Human) (Target 2)

K1303503 1.0 ug DNA
EUR 154

MINA sgRNA CRISPR Lentivector (Human) (Target 3)

K1303504 1.0 ug DNA
EUR 154

Mina sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3553902 1.0 ug DNA
EUR 154

Mina sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3553903 1.0 ug DNA
EUR 154

Mina sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3553904 1.0 ug DNA
EUR 154

Mina sgRNA CRISPR Lentivector (Rat) (Target 1)

K7143602 1.0 ug DNA
EUR 154

Mina sgRNA CRISPR Lentivector (Rat) (Target 2)

K7143603 1.0 ug DNA
EUR 154

Mina sgRNA CRISPR Lentivector (Rat) (Target 3)

K7143604 1.0 ug DNA
EUR 154

Recombinant Human MINA Protein, His, E.coli-100ug

QP12698-100ug 100ug
EUR 1261

Recombinant Human MINA Protein, His, E.coli-10ug

QP12698-10ug 10ug
EUR 201

Recombinant Human MINA Protein, His, E.coli-2ug

QP12698-2ug 2ug
EUR 155

MINA Protein Vector (Rat) (pPB-C-His)

PV282374 500 ng
EUR 603

MINA Protein Vector (Rat) (pPB-N-His)

PV282375 500 ng
EUR 603

MINA Protein Vector (Rat) (pPM-C-HA)

PV282376 500 ng
EUR 603

MINA Protein Vector (Rat) (pPM-C-His)

PV282377 500 ng
EUR 603

MINA Protein Vector (Human) (pPB-C-His)

PV025981 500 ng
EUR 329

MINA Protein Vector (Human) (pPB-N-His)

PV025982 500 ng
EUR 329

MINA Protein Vector (Human) (pPM-C-HA)

PV025983 500 ng
EUR 329

MINA Protein Vector (Human) (pPM-C-His)

PV025984 500 ng
EUR 329

MINA Protein Vector (Mouse) (pPB-C-His)

PV200910 500 ng
EUR 603

MINA Protein Vector (Mouse) (pPB-N-His)

PV200911 500 ng
EUR 603

MINA Protein Vector (Mouse) (pPM-C-HA)

PV200912 500 ng
EUR 603

MINA Protein Vector (Mouse) (pPM-C-His)

PV200913 500 ng
EUR 603

Mina 3'UTR GFP Stable Cell Line

TU163208 1.0 ml Ask for price

Mina 3'UTR Luciferase Stable Cell Line

TU213198 1.0 ml Ask for price

MINA 3'UTR Luciferase Stable Cell Line

TU013367 1.0 ml
EUR 2333

Mina 3'UTR Luciferase Stable Cell Line

TU113208 1.0 ml Ask for price

MINA 3'UTR GFP Stable Cell Line

TU063367 1.0 ml
EUR 2333

Mina 3'UTR GFP Stable Cell Line

TU263198 1.0 ml Ask for price

Human MYC Induced Nuclear Antigen (MINA) CLIA Kit

20-abx495963
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human MYC- induced nuclear antigen, MINA ELISA KIT

ELI-13035h 96 Tests
EUR 824

Bovine MYC- induced nuclear antigen, MINA ELISA KIT

ELI-14030b 96 Tests
EUR 928

Mouse Myc- induced nuclear antigen, Mina ELISA KIT

ELI-16296m 96 Tests
EUR 865

Human MYC Induced Nuclear Antigen (MINA) ELISA Kit

20-abx258654
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

MINA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV683785 1.0 ug DNA
EUR 682

MINA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV683789 1.0 ug DNA
EUR 682

MINA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV683790 1.0 ug DNA
EUR 682

MINA MYC Induced Nuclear Antigen Human Recombinant Protein

PROTQ8IUF8 Regular: 10ug
EUR 317
Description: MINA Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 485 amino acids (1-465 a.a) and having a molecular mass of 54.9kDa.

Human MYC Induced Nuclear Antigen (MINA) ELISA Kit

SEL720Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MYC Induced Nuclear Antigen (MINA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MYC Induced Nuclear Antigen (MINA) in Tissue homogenates, cell lysates and other biological fluids.

Human MYC Induced Nuclear Antigen (MINA) ELISA Kit

SEL720Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MYC Induced Nuclear Antigen (MINA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MYC Induced Nuclear Antigen (MINA) in Tissue homogenates, cell lysates and other biological fluids.

Human MYC Induced Nuclear Antigen (MINA) ELISA Kit

SEL720Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MYC Induced Nuclear Antigen (MINA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MYC Induced Nuclear Antigen (MINA) in Tissue homogenates, cell lysates and other biological fluids.

Human MYC Induced Nuclear Antigen (MINA) ELISA Kit

SEL720Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MYC Induced Nuclear Antigen (MINA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MYC Induced Nuclear Antigen (MINA) in Tissue homogenates, cell lysates and other biological fluids.

Human MYC Induced Nuclear Antigen (MINA) ELISA Kit

4-SEL720Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MYC Induced Nuclear Antigen elisa. Alternative names of the recognized antigen: MDIG
  • NO52
  • MINA53
  • ROX
  • Mineral dust-induced gene protein
  • Nucleolar protein 52
  • 60S ribosomal protein L27a histidine hydroxylase
  • Ribosomal oxygenase MINA
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MYC Induced Nuclear Antigen (MINA) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody

ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody

ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody

ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody

ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody

ABP57580-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody

ABP57580-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody

ABP57580-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody

ABP57581-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57581-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57581-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody

ABP57582-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody

ABP57583-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody

ABP57583-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody

ABP57583-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody

ABP57585-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57585-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57585-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody

ABP57586-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

MINA Rabbit Polyclonal Antibody