NEK2 Rabbit Polyclonal Antibody
NEK2 Rabbit pAb |
A13334-100ul |
Abclonal |
100 ul |
EUR 308 |
NEK2 Rabbit pAb |
A13334-200ul |
Abclonal |
200 ul |
EUR 459 |
NEK2 Rabbit pAb |
A13334-20ul |
Abclonal |
20 ul |
EUR 183 |
NEK2 Rabbit pAb |
A13334-50ul |
Abclonal |
50 ul |
EUR 223 |
NEK2 Rabbit pAb |
A5355-100ul |
Abclonal |
100 ul |
EUR 308 |
NEK2 Rabbit pAb |
A5355-200ul |
Abclonal |
200 ul |
EUR 459 |
NEK2 Rabbit pAb |
A5355-20ul |
Abclonal |
20 ul |
EUR 183 |
NEK2 Rabbit pAb |
A5355-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal NEK2 Antibody (Center) |
APR06062G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (Center). This antibody is tested and proven to work in the following applications: |
NEK2 antibody |
70R-18839 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NEK2 antibody |
NEK2 Antibody |
32795-100ul |
SAB |
100ul |
EUR 252 |
NEK2 Antibody |
DF2669 |
Affbiotech |
200ul |
EUR 304 |
Description: NEK2 antibody detects endogenous levels of total NEK2. |
NEK2 Antibody |
DF7296 |
Affbiotech |
200ul |
EUR 304 |
Description: NEK2 Antibody detects endogenous levels of total NEK2. |
NEK2 Antibody |
1-CSB-PA295415 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
NEK2 Antibody |
1-CSB-PA015699ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NEK2 Antibody |
1-CSB-PA015699GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NEK2 Antibody |
AF7557 |
Affbiotech |
200ul |
EUR 376 |
Description: NEK2 Antibody detects endogenous levels of NEK2. |
Polyclonal NEK2 Antibody (aa287-299) |
APR02189G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (aa287-299). This antibody is tested and proven to work in the following applications: |
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx025140-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx025140-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx004096 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx213477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx146251-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx142097 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx033852-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx033852-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
20-abx320236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx235651-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody |
abx235652-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
NEK2 (Phospho-Ser170) Polyclonal Conjugated Antibody |
C12922 |
SAB |
100ul |
EUR 397 |
Anti-NEK2 Antibody |
A01606 |
BosterBio |
100ug |
EUR 432 |
Description: Rabbit Polyclonal NEK2 Antibody. Validated in WB and tested in Human. |
NEK2 Conjugated Antibody |
C32795 |
SAB |
100ul |
EUR 397 |
anti- NEK2 antibody |
FNab05651 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: NIMA (never in mitosis gene a)-related kinase 2
- Uniprot ID: P51955
- Gene ID: 4751
- Research Area: Metabolism
|
Description: Antibody raised against NEK2 |
anti- NEK2 antibody |
FNab05652 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: NIMA(never in mitosis gene a)-related kinase 2
- Uniprot ID: P51955
- Research Area: Metabolism
|
Description: Antibody raised against NEK2 |
Anti-NEK2 antibody |
STJ27308 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. |
Anti-NEK2 antibody |
STJ115297 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. |
Anti-NEK2 antibody |
STJ191974 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NEK2 |
NEK2 protein |
30R-2834 |
Fitzgerald |
5 ug |
EUR 503 |
Description: Purified recombinant Human NEK2 protein |
NEK2 siRNA |
20-abx925714 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEK2 siRNA |
20-abx925715 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NEK2 |
YF-PA13411 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to NEK2 |
anti-NEK2 |
YF-PA13412 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NEK2 |
anti-NEK2 |
YF-PA13413 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to NEK2 |
anti-NEK2 |
YF-PA13414 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NEK2 |
NEK2 (Phospho-Ser170) Antibody |
12922-100ul |
SAB |
100ul |
EUR 252 |
NEK2 (Phospho-Ser170) Antibody |
12922-50ul |
SAB |
50ul |
EUR 187 |
Phospho-NEK2(Ser170) Antibody |
AF7057 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-NEK2(Ser170) Antibody detects endogenous levels of NEK2 only when phosphorylated at Ser170. |
NEK2 Blocking Peptide |
DF2669-BP |
Affbiotech |
1mg |
EUR 195 |
NEK2 Blocking Peptide |
DF7296-BP |
Affbiotech |
1mg |
EUR 195 |
NEK2 Blocking Peptide |
AF7557-BP |
Affbiotech |
1mg |
EUR 195 |
NEK2 cloning plasmid |
CSB-CL015699HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 645
- Sequence: atgccttcccgggctgaggactatgaagtgttgtacaccattggcacaggctcctacggccgctgccagaagatccggaggaagagtgatggcaagatattagtttggaaagaacttgactatggctccatgacagaagctgagaaacagatgcttgtttctgaagtgaatttgct
- Show more
|
Description: A cloning plasmid for the NEK2 gene. |
Anti-NEK2 (2F6) |
YF-MA10616 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (2F9) |
YF-MA14408 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (2A10) |
YF-MA14409 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (1C8) |
YF-MA14410 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Anti-NEK2 (3B7) |
YF-MA14411 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK2 |
Human Serine, threonine-protein kinase Nek2 (NEK2) ELISA Kit |
abx257267-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human NEK2(Serine/threonine-protein kinase Nek2) ELISA Kit |
EH4130 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P51955
- Alias: HSPK 21/Never in mitosis A-related kinase 2/NimA-related protein kinase 2/NimA-like protein kinase 1/NEK2A/NLK1
|
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Mouse Serine/threonine- protein kinase Nek2, Nek2 ELISA KIT |
ELI-42481m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Serine/threonine- protein kinase Nek2, NEK2 ELISA KIT |
ELI-36500h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse NEK2 shRNA Plasmid |
20-abx971710 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NEK2 shRNA Plasmid |
20-abx953154 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal NEK2 Antibody (clone 2F6), Clone: 2F6 |
AMM02013G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human NEK2 (clone 2F6). The antibodies are raised in Mouse and are from clone 2F6. This antibody is applicable in WB and IHC-P, E, IP |
Monoclonal NEK2 Antibody (monoclonal) (M02), Clone: 2F9 |
AMM03848G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2F9. This antibody is applicable in WB and IF, E |
Monoclonal NEK2 Antibody (monoclonal) (M11), Clone: 3B7 |
AMM03849G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M11). The antibodies are raised in mouse and are from clone 3B7. This antibody is applicable in WB and IF |
Phospho-NEK2(Ser170) Blocking Peptide |
AF7057-BP |
Affbiotech |
1mg |
EUR 195 |
Nek2 ORF Vector (Rat) (pORF) |
ORF071223 |
ABM |
1.0 ug DNA |
EUR 506 |
NEK2 Rabbit Polyclonal Antibody