NEK2 Rabbit Polyclonal Antibody

NEK2 Rabbit Polyclonal Antibody

NEK2 Rabbit pAb

A13334-100ul 100 ul
EUR 308

NEK2 Rabbit pAb

A13334-200ul 200 ul
EUR 459

NEK2 Rabbit pAb

A13334-20ul 20 ul
EUR 183

NEK2 Rabbit pAb

A13334-50ul 50 ul
EUR 223

NEK2 Rabbit pAb

A5355-100ul 100 ul
EUR 308

NEK2 Rabbit pAb

A5355-200ul 200 ul
EUR 459

NEK2 Rabbit pAb

A5355-20ul 20 ul
EUR 183

NEK2 Rabbit pAb

A5355-50ul 50 ul
EUR 223

Polyclonal NEK2 Antibody (Center)

APR06062G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (Center). This antibody is tested and proven to work in the following applications:

NEK2 antibody

70R-18839 50 ul
EUR 435
Description: Rabbit polyclonal NEK2 antibody

NEK2 Antibody

32795-100ul 100ul
EUR 252

NEK2 Antibody

DF2669 200ul
EUR 304
Description: NEK2 antibody detects endogenous levels of total NEK2.

NEK2 Antibody

DF7296 200ul
EUR 304
Description: NEK2 Antibody detects endogenous levels of total NEK2.

NEK2 Antibody

1-CSB-PA295415
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

NEK2 Antibody

1-CSB-PA015699ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NEK2 Antibody

1-CSB-PA015699GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NEK2 Antibody

AF7557 200ul
EUR 376
Description: NEK2 Antibody detects endogenous levels of NEK2.

NEK2 Antibody

ABD2669 100 ug
EUR 438

NEK2 Antibody

ABD7296 100 ug
EUR 438

Polyclonal NEK2 Antibody (aa287-299)

APR02189G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (aa287-299). This antibody is tested and proven to work in the following applications:

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx025140-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx025140-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx004096
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx213477
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx146251-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx142097
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx033852-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx033852-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx320236
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx235651-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx235652-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NEK2 (Phospho-Ser170) Polyclonal Conjugated Antibody

C12922 100ul
EUR 397

Anti-NEK2 Antibody

A01606 100ug
EUR 432
Description: Rabbit Polyclonal NEK2 Antibody. Validated in WB and tested in Human.

NEK2 Conjugated Antibody

C32795 100ul
EUR 397

anti- NEK2 antibody

FNab05651 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: NIMA (never in mitosis gene a)-related kinase 2
  • Uniprot ID: P51955
  • Gene ID: 4751
  • Research Area: Metabolism
Description: Antibody raised against NEK2

anti- NEK2 antibody

FNab05652 100µg
EUR 548.75
  • Immunogen: NIMA(never in mitosis gene a)-related kinase 2
  • Uniprot ID: P51955
  • Research Area: Metabolism
Description: Antibody raised against NEK2

Anti-NEK2 antibody

PAab05651 100 ug
EUR 386

Anti-NEK2 antibody

PAab05652 100 ug
EUR 386

Anti-NEK2 antibody

STJ27308 100 µl
EUR 277
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene.

Anti-NEK2 antibody

STJ115297 100 µl
EUR 277
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene.

Anti-NEK2 antibody

STJ191974 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEK2

NEK2 protein

30R-2834 5 ug
EUR 503
Description: Purified recombinant Human NEK2 protein

NEK2, Active

7719-5
EUR 370

NEK2 siRNA

20-abx925714
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEK2 siRNA

20-abx925715
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NEK2

YF-PA13411 50 ul
EUR 363
Description: Mouse polyclonal to NEK2

anti-NEK2

YF-PA13412 50 ug
EUR 363
Description: Mouse polyclonal to NEK2

anti-NEK2

YF-PA13413 100 ul
EUR 403
Description: Rabbit polyclonal to NEK2

anti-NEK2

YF-PA13414 100 ug
EUR 403
Description: Rabbit polyclonal to NEK2

NEK2 (Phospho-Ser170) Antibody

12922-100ul 100ul
EUR 252

NEK2 (Phospho-Ser170) Antibody

12922-50ul 50ul
EUR 187

Phospho-NEK2(Ser170) Antibody

AF7057 200ul
EUR 376
Description: Phospho-NEK2(Ser170) Antibody detects endogenous levels of NEK2 only when phosphorylated at Ser170.

NEK2 Blocking Peptide

DF2669-BP 1mg
EUR 195

NEK2 Blocking Peptide

DF7296-BP 1mg
EUR 195

NEK2 Blocking Peptide

AF7557-BP 1mg
EUR 195

NEK2 cloning plasmid

CSB-CL015699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgccttcccgggctgaggactatgaagtgttgtacaccattggcacaggctcctacggccgctgccagaagatccggaggaagagtgatggcaagatattagtttggaaagaacttgactatggctccatgacagaagctgagaaacagatgcttgtttctgaagtgaatttgct
  • Show more
Description: A cloning plasmid for the NEK2 gene.

Anti-NEK2 (2F6)

YF-MA10616 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (2F9)

YF-MA14408 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (2A10)

YF-MA14409 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (1C8)

YF-MA14410 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (3B7)

YF-MA14411 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Human Serine, threonine-protein kinase Nek2 (NEK2) ELISA Kit

abx257267-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human NEK2(Serine/threonine-protein kinase Nek2) ELISA Kit

EH4130 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P51955
  • Alias: HSPK 21/Never in mitosis A-related kinase 2/NimA-related protein kinase 2/NimA-like protein kinase 1/NEK2A/NLK1
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Serine/threonine- protein kinase Nek2, Nek2 ELISA KIT

ELI-42481m 96 Tests
EUR 865

Human Serine/threonine- protein kinase Nek2, NEK2 ELISA KIT

ELI-36500h 96 Tests
EUR 824

NEK2 ELISA KIT|Human

EF007336 96 Tests
EUR 689

Mouse NEK2 shRNA Plasmid

20-abx971710
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NEK2 shRNA Plasmid

20-abx953154
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal NEK2 Antibody (clone 2F6), Clone: 2F6

AMM02013G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NEK2 (clone 2F6). The antibodies are raised in Mouse and are from clone 2F6. This antibody is applicable in WB and IHC-P, E, IP

Monoclonal NEK2 Antibody (monoclonal) (M02), Clone: 2F9

AMM03848G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2F9. This antibody is applicable in WB and IF, E

Monoclonal NEK2 Antibody (monoclonal) (M11), Clone: 3B7

AMM03849G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M11). The antibodies are raised in mouse and are from clone 3B7. This antibody is applicable in WB and IF

Phospho-NEK2(Ser170) Blocking Peptide

AF7057-BP 1mg
EUR 195

Nek2 ORF Vector (Rat) (pORF)

ORF071223 1.0 ug DNA
EUR 506

NEK2 Rabbit Polyclonal Antibody