NEK3 Rabbit Polyclonal Antibody

NEK3 Rabbit Polyclonal Antibody

NEK3 Polyclonal Antibody

ABP59443-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NEK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEK3 from Mouse. This NEK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK3 protein

NEK3 Polyclonal Antibody

ABP59443-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NEK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEK3 from Mouse. This NEK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK3 protein

NEK3 Polyclonal Antibody

ABP59443-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NEK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEK3 from Mouse. This NEK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK3 protein

NEK3 Rabbit pAb

A6665-100ul 100 ul
EUR 308

NEK3 Rabbit pAb

A6665-200ul 200 ul
EUR 459

NEK3 Rabbit pAb

A6665-20ul 20 ul
EUR 183

NEK3 Rabbit pAb

A6665-50ul 50 ul
EUR 223

Polyclonal NEK3 Antibody (Center)

APR06063G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK3 (Center). This antibody is tested and proven to work in the following applications:

NEK3 antibody

70R-5504 50 ug
EUR 467
Description: Rabbit polyclonal NEK3 antibody

NEK3 Antibody

ABD10137 100 ug
EUR 438

NEK3 antibody

39085-100ul 100ul
EUR 252

NEK3 Antibody

DF10137 200ul
EUR 304
Description: NEK3 Antibody detects endogenous levels of total NEK3.

NEK3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEK3. Recognizes NEK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NEK3 Conjugated Antibody

C39085 100ul
EUR 397

anti- NEK3 antibody

FNab05653 100µg
EUR 505.25
  • Immunogen: NIMA(never in mitosis gene a)-related kinase 3
  • Uniprot ID: P51956
  • Gene ID: 4752
  • Research Area: Metabolism
Description: Antibody raised against NEK3

Mouse Nek3 Antibody

abx027690-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Nek3 Antibody

abx027690-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-NEK3 antibody

PAab05653 100 ug
EUR 355

Anti-NEK3 antibody

STJ28748 100 µl
EUR 277
Description: This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-NEK3 antibody

STJ191975 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEK3

Polyclonal Mouse Nek3 Antibody (C-term)

APR03888G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Nek3 (C-term). This antibody is tested and proven to work in the following applications:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13415 50 ul
EUR 363
Description: Mouse polyclonal to NEK3


YF-PA13416 50 ug
EUR 363
Description: Mouse polyclonal to NEK3


YF-PA13417 100 ul
EUR 403
Description: Rabbit polyclonal to NEK3


YF-PA13418 100 ug
EUR 403
Description: Rabbit polyclonal to NEK3

NEK3 cloning plasmid

CSB-CL015701HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1521
  • Sequence: atggatgactacatggtcctgagaatgattggggagggctccttcggcagagctcttttggttcagcatgaaagcagtaatcagatgtttgccatgaaagaaataaggcttcccaagtctttctctaatacacagaattctaggaaggaggctgttcttttagccaaaatgaaac
  • Show more
Description: A cloning plasmid for the NEK3 gene.

NEK3 Blocking Peptide

33R-3099 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEK3 antibody, catalog no. 70R-5504

NEK3 Blocking Peptide

DF10137-BP 1mg
EUR 195

Anti-NEK3 (2F8)

YF-MA14412 100 ug
EUR 363
Description: Mouse monoclonal to NEK3

Human Serine/threonine- protein kinase Nek3, NEK3 ELISA KIT

ELI-44061h 96 Tests
EUR 824

Mouse Serine/threonine- protein kinase Nek3, Nek3 ELISA KIT

ELI-44062m 96 Tests
EUR 865

Mouse NEK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001171 96 Tests
EUR 689

Human NEK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-NEK3 Plasmid

PVT16184 2 ug
EUR 325

NIMA Related Kinase 3 (NEK3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody

abx033853-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody

abx033853-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody

abx235653-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Monoclonal NEK3 Antibody (monoclonal) (M01), Clone: 2F8

AMM03850G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEK3 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2F8. This antibody is applicable in WB and IF, E

NEK3 ORF Vector (Human) (pORF)

ORF007022 1.0 ug DNA
EUR 95

Nek3 ORF Vector (Mouse) (pORF)

ORF051218 1.0 ug DNA
EUR 506

Nek3 ORF Vector (Mouse) (pORF)

ORF051219 1.0 ug DNA
EUR 506

NEK3 sgRNA CRISPR Lentivector set (Human)

K1416501 3 x 1.0 ug
EUR 339

Nek3 sgRNA CRISPR Lentivector set (Mouse)

K3812701 3 x 1.0 ug
EUR 339

NEK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1416502 1.0 ug DNA
EUR 154

NEK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1416503 1.0 ug DNA
EUR 154

NEK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1416504 1.0 ug DNA
EUR 154

Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3812702 1.0 ug DNA
EUR 154

Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3812703 1.0 ug DNA
EUR 154

Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3812704 1.0 ug DNA
EUR 154

NEK3 Protein Vector (Human) (pPB-C-His)

PV028085 500 ng
EUR 329

NEK3 Protein Vector (Human) (pPB-N-His)

PV028086 500 ng
EUR 329

NEK3 Protein Vector (Human) (pPM-C-HA)

PV028087 500 ng
EUR 329

NEK3 Protein Vector (Human) (pPM-C-His)

PV028088 500 ng
EUR 329

NEK3 Protein Vector (Mouse) (pPB-C-His)

PV204870 500 ng
EUR 603

NEK3 Protein Vector (Mouse) (pPB-N-His)

PV204871 500 ng
EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-HA)

PV204872 500 ng
EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-His)

PV204873 500 ng
EUR 603

NEK3 Protein Vector (Mouse) (pPB-C-His)

PV204874 500 ng
EUR 603

NEK3 Protein Vector (Mouse) (pPB-N-His)

PV204875 500 ng
EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-HA)

PV204876 500 ng
EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-His)

PV204877 500 ng
EUR 603

Nek3 3'UTR GFP Stable Cell Line

TU163987 1.0 ml Ask for price

Nek3 3'UTR Luciferase Stable Cell Line

TU213884 1.0 ml Ask for price

NEK3 3'UTR Luciferase Stable Cell Line

TU015571 1.0 ml
EUR 1394

Nek3 3'UTR Luciferase Stable Cell Line

TU113987 1.0 ml Ask for price

NEK3 3'UTR GFP Stable Cell Line

TU065571 1.0 ml
EUR 1394

Nek3 3'UTR GFP Stable Cell Line

TU263884 1.0 ml Ask for price

Human NIMA Related Kinase 3 (NEK3) ELISA Kit

abx381762-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NEK3 Rabbit Polyclonal Antibody