NEK3 Rabbit Polyclonal Antibody

NEK3 Rabbit Polyclonal Antibody

NEK3 Polyclonal Antibody
ABP59443-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NEK3 protein Applications tips:
Description: A polyclonal antibody for detection of NEK3 from Mouse. This NEK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK3 protein

NEK3 Polyclonal Antibody
ES10817-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NEK3 from Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEK3 Polyclonal Antibody
ES10817-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NEK3 from Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEK3 Rabbit pAb
A6665-100ul	Abclonal	100 ul	EUR 308

NEK3 Rabbit pAb
A6665-200ul	Abclonal	200 ul	EUR 459

NEK3 Rabbit pAb
A6665-20ul	Abclonal	20 ul	EUR 183

NEK3 Rabbit pAb
A6665-50ul	Abclonal	50 ul	EUR 223

Polyclonal NEK3 Antibody (Center)
APR06063G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK3 (Center). This antibody is tested and proven to work in the following applications:

NEK3 antibody
39085-100ul	SAB	100ul	EUR 252

NEK3 Antibody
DF10137	Affbiotech	200ul	EUR 304
Description: NEK3 Antibody detects endogenous levels of total NEK3.

NEK3 Antibody
1-CSB-PA015701ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEK3. Recognizes NEK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NEK3 antibody
70R-5504	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NEK3 antibody

NEK3 Antibody
ABD10137	Lifescience Market	100 ug	EUR 438

Mouse Nek3 Antibody
abx027690-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Nek3 Antibody
abx027690-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

NEK3 Conjugated Antibody
C39085	SAB	100ul	EUR 397

anti- NEK3 antibody
FNab05653	FN Test	100µg	EUR 505.25
Immunogen: NIMA(never in mitosis gene a)-related kinase 3 Uniprot ID: P51956 Gene ID: 4752 Research Area: Metabolism
Description: Antibody raised against NEK3

Anti-NEK3 antibody
PAab05653	Lifescience Market	100 ug	EUR 355

Anti-NEK3 antibody
STJ28748	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-NEK3 antibody
STJ191975	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NEK3

Polyclonal Mouse Nek3 Antibody (C-term)
APR03888G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Nek3 (C-term). This antibody is tested and proven to work in the following applications:

NEK3 siRNA
20-abx925716	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NEK3 siRNA
20-abx925717	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NEK3
YF-PA13415	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to NEK3

anti-NEK3
YF-PA13416	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NEK3

anti-NEK3
YF-PA13417	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to NEK3

anti-NEK3
YF-PA13418	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to NEK3

NEK3 Blocking Peptide
33R-3099	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEK3 antibody, catalog no. 70R-5504

NEK3 Blocking Peptide
DF10137-BP	Affbiotech	1mg	EUR 195

NEK3 cloning plasmid
CSB-CL015701HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1521 Sequence: atggatgactacatggtcctgagaatgattggggagggctccttcggcagagctcttttggttcagcatgaaagcagtaatcagatgtttgccatgaaagaaataaggcttcccaagtctttctctaatacacagaattctaggaaggaggctgttcttttagccaaaatgaaac Show more
Description: A cloning plasmid for the NEK3 gene.

Anti-NEK3 (2F8)
YF-MA14412	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NEK3

Human Serine/threonine- protein kinase Nek3, NEK3 ELISA KIT
ELI-44061h	Lifescience Market	96 Tests	EUR 824

Mouse Serine/threonine- protein kinase Nek3, Nek3 ELISA KIT
ELI-44062m	Lifescience Market	96 Tests	EUR 865

NEK3 ELISA KIT|Human
EF001171	Lifescience Market	96 Tests	EUR 689

Mouse NEK3 shRNA Plasmid
20-abx973571	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NEK3 shRNA Plasmid
20-abx953155	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-NEK3 Plasmid
PVT16184	Lifescience Market	2 ug	EUR 325

NIMA Related Kinase 3 (NEK3) Antibody
20-abx005111	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody
20-abx141364	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody
abx033853-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody
abx033853-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

NIMA Related Kinase 3 (NEK3) Antibody
abx235653-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

NIMA Related Kinase 3 (NEK3) Antibody
20-abx321804	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Monoclonal NEK3 Antibody (monoclonal) (M01), Clone: 2F8
AMM03850G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NEK3 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2F8. This antibody is applicable in WB and IF, E

NEK3 ORF Vector (Human) (pORF)
ORF007022	ABM	1.0 ug DNA	EUR 95

Nek3 ORF Vector (Mouse) (pORF)
ORF051218	ABM	1.0 ug DNA	EUR 506

Nek3 ORF Vector (Mouse) (pORF)
ORF051219	ABM	1.0 ug DNA	EUR 506

Nek3 sgRNA CRISPR Lentivector set (Mouse)
K3812701	ABM	3 x 1.0 ug	EUR 339

NEK3 sgRNA CRISPR Lentivector set (Human)
K1416501	ABM	3 x 1.0 ug	EUR 339

Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3812702	ABM	1.0 ug DNA	EUR 154

Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3812703	ABM	1.0 ug DNA	EUR 154

Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3812704	ABM	1.0 ug DNA	EUR 154

NEK3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1416502	ABM	1.0 ug DNA	EUR 154

NEK3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1416503	ABM	1.0 ug DNA	EUR 154

NEK3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1416504	ABM	1.0 ug DNA	EUR 154

NEK3 Protein Vector (Mouse) (pPB-C-His)
PV204870	ABM	500 ng	EUR 603

NEK3 Protein Vector (Mouse) (pPB-N-His)
PV204871	ABM	500 ng	EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-HA)
PV204872	ABM	500 ng	EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-His)
PV204873	ABM	500 ng	EUR 603

NEK3 Protein Vector (Mouse) (pPB-C-His)
PV204874	ABM	500 ng	EUR 603

NEK3 Protein Vector (Mouse) (pPB-N-His)
PV204875	ABM	500 ng	EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-HA)
PV204876	ABM	500 ng	EUR 603

NEK3 Protein Vector (Mouse) (pPM-C-His)
PV204877	ABM	500 ng	EUR 603

NEK3 Protein Vector (Human) (pPB-C-His)
PV028085	ABM	500 ng	EUR 329

NEK3 Protein Vector (Human) (pPB-N-His)
PV028086	ABM	500 ng	EUR 329

NEK3 Protein Vector (Human) (pPM-C-HA)
PV028087	ABM	500 ng	EUR 329

NEK3 Protein Vector (Human) (pPM-C-His)
PV028088	ABM	500 ng	EUR 329

Nek3 3'UTR Luciferase Stable Cell Line
TU113987	ABM	1.0 ml	Ask for price

Nek3 3'UTR GFP Stable Cell Line
TU163987	ABM	1.0 ml	Ask for price

Nek3 3'UTR Luciferase Stable Cell Line
TU213884	ABM	1.0 ml	Ask for price

Nek3 3'UTR GFP Stable Cell Line
TU263884	ABM	1.0 ml	Ask for price

NEK3 3'UTR GFP Stable Cell Line
TU065571	ABM	1.0 ml	EUR 1394

NEK3 3'UTR Luciferase Stable Cell Line
TU015571	ABM	1.0 ml	EUR 1394

Human NIMA Related Kinase 3 (NEK3) ELISA Kit
abx381762-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NEK3 Rabbit Polyclonal Antibody