NEK3 Rabbit Polyclonal Antibody
 NEK3 Polyclonal Antibody |
|
ABP59443-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NEK3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NEK3 from Mouse. This NEK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK3 protein |
NEK3 Polyclonal Antibody |
|
ABP59443-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NEK3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NEK3 from Mouse. This NEK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK3 protein |
NEK3 Polyclonal Antibody |
|
ABP59443-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NEK3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NEK3 from Mouse. This NEK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEK3 protein |
 NEK3 Rabbit pAb |
|
A6665-100ul |
Abclonal |
100 ul |
EUR 308 |
NEK3 Rabbit pAb |
|
A6665-200ul |
Abclonal |
200 ul |
EUR 459 |
NEK3 Rabbit pAb |
|
A6665-20ul |
Abclonal |
20 ul |
EUR 183 |
NEK3 Rabbit pAb |
|
A6665-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal NEK3 Antibody (Center) |
|
APR06063G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK3 (Center). This antibody is tested and proven to work in the following applications: |
 NEK3 antibody |
|
70R-5504 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal NEK3 antibody |
NEK3 antibody |
|
39085-100ul |
SAB |
100ul |
EUR 252 |
 NEK3 Antibody |
|
DF10137 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NEK3 Antibody detects endogenous levels of total NEK3. |
NEK3 Antibody |
|
1-CSB-PA015701ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against NEK3. Recognizes NEK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
 NEK3 Conjugated Antibody |
|
C39085 |
SAB |
100ul |
EUR 397 |
 anti- NEK3 antibody |
|
FNab05653 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: NIMA(never in mitosis gene a)-related kinase 3
- Uniprot ID: P51956
- Gene ID: 4752
- Research Area: Metabolism
|
|
Description: Antibody raised against NEK3 |
 Mouse Nek3 Antibody |
|
abx027690-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mouse Nek3 Antibody |
|
abx027690-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 Anti-NEK3 antibody |
|
STJ28748 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-NEK3 antibody |
|
STJ191975 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NEK3 |
) Polyclonal Mouse Nek3 Antibody (C-term) |
|
APR03888G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Nek3 (C-term). This antibody is tested and proven to work in the following applications: |
 NEK3 siRNA |
|
20-abx925716 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEK3 siRNA |
|
20-abx925717 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-NEK3 |
|
YF-PA13415 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to NEK3 |
anti-NEK3 |
|
YF-PA13416 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to NEK3 |
anti-NEK3 |
|
YF-PA13417 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to NEK3 |
anti-NEK3 |
|
YF-PA13418 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to NEK3 |
 NEK3 cloning plasmid |
|
CSB-CL015701HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1521
- Sequence: atggatgactacatggtcctgagaatgattggggagggctccttcggcagagctcttttggttcagcatgaaagcagtaatcagatgtttgccatgaaagaaataaggcttcccaagtctttctctaatacacagaattctaggaaggaggctgttcttttagccaaaatgaaac
- Show more
|
|
Description: A cloning plasmid for the NEK3 gene. |
 NEK3 Blocking Peptide |
|
33R-3099 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEK3 antibody, catalog no. 70R-5504 |
NEK3 Blocking Peptide |
|
DF10137-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-NEK3 (2F8) |
|
YF-MA14412 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NEK3 |
 Human Serine/threonine- protein kinase Nek3, NEK3 ELISA KIT |
|
ELI-44061h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Serine/threonine- protein kinase Nek3, Nek3 ELISA KIT |
|
ELI-44062m |
Lifescience Market |
96 Tests |
EUR 865 |
 Mouse NEK3 shRNA Plasmid |
|
20-abx973571 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NEK3 shRNA Plasmid |
|
20-abx953155 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) NIMA Related Kinase 3 (NEK3) Antibody |
|
20-abx141364 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
NIMA Related Kinase 3 (NEK3) Antibody |
|
abx033853-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
NIMA Related Kinase 3 (NEK3) Antibody |
|
abx033853-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
NIMA Related Kinase 3 (NEK3) Antibody |
|
20-abx005111 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
NIMA Related Kinase 3 (NEK3) Antibody |
|
20-abx321804 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NIMA Related Kinase 3 (NEK3) Antibody |
|
abx235653-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 (M01), Clone: 2F8) Monoclonal NEK3 Antibody (monoclonal) (M01), Clone: 2F8 |
|
AMM03850G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NEK3 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2F8. This antibody is applicable in WB and IF, E |
 (pORF)) NEK3 ORF Vector (Human) (pORF) |
|
ORF007022 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nek3 ORF Vector (Mouse) (pORF) |
|
ORF051218 |
ABM |
1.0 ug DNA |
EUR 506 |
Nek3 ORF Vector (Mouse) (pORF) |
|
ORF051219 |
ABM |
1.0 ug DNA |
EUR 506 |
) NEK3 sgRNA CRISPR Lentivector set (Human) |
|
K1416501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nek3 sgRNA CRISPR Lentivector set (Mouse) |
|
K3812701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) NEK3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1416502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NEK3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1416503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NEK3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1416504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3812702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3812703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nek3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3812704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NEK3 Protein Vector (Human) (pPB-C-His) |
|
PV028085 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NEK3 Protein Vector (Human) (pPB-N-His) |
|
PV028086 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NEK3 Protein Vector (Human) (pPM-C-HA) |
|
PV028087 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NEK3 Protein Vector (Human) (pPM-C-His) |
|
PV028088 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) NEK3 Protein Vector (Mouse) (pPB-C-His) |
|
PV204870 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NEK3 Protein Vector (Mouse) (pPB-N-His) |
|
PV204871 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NEK3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV204872 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NEK3 Protein Vector (Mouse) (pPM-C-His) |
|
PV204873 |
ABM |
500 ng |
EUR 603 |
NEK3 Protein Vector (Mouse) (pPB-C-His) |
|
PV204874 |
ABM |
500 ng |
EUR 603 |
NEK3 Protein Vector (Mouse) (pPB-N-His) |
|
PV204875 |
ABM |
500 ng |
EUR 603 |
NEK3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV204876 |
ABM |
500 ng |
EUR 603 |
NEK3 Protein Vector (Mouse) (pPM-C-His) |
|
PV204877 |
ABM |
500 ng |
EUR 603 |
 Nek3 3'UTR GFP Stable Cell Line |
|
TU163987 |
ABM |
1.0 ml |
Ask for price |
 Nek3 3'UTR Luciferase Stable Cell Line |
|
TU213884 |
ABM |
1.0 ml |
Ask for price |
 NEK3 3'UTR Luciferase Stable Cell Line |
|
TU015571 |
ABM |
1.0 ml |
EUR 1394 |
Nek3 3'UTR Luciferase Stable Cell Line |
|
TU113987 |
ABM |
1.0 ml |
Ask for price |
 NEK3 3'UTR GFP Stable Cell Line |
|
TU065571 |
ABM |
1.0 ml |
EUR 1394 |
Nek3 3'UTR GFP Stable Cell Line |
|
TU263884 |
ABM |
1.0 ml |
Ask for price |
 ELISA Kit) Human NIMA Related Kinase 3 (NEK3) ELISA Kit |
|
abx381762-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
NEK3 Rabbit Polyclonal Antibody
