NR0B1 Rabbit Polyclonal Antibody
NR0B1 Polyclonal Antibody |
ABP59519-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NR0B1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NR0B1 from Human. This NR0B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR0B1 protein |
NR0B1 Rabbit pAb |
A1740-100ul |
Abclonal |
100 ul |
EUR 308 |
NR0B1 Rabbit pAb |
A1740-200ul |
Abclonal |
200 ul |
EUR 459 |
NR0B1 Rabbit pAb |
A1740-20ul |
Abclonal |
20 ul |
EUR 183 |
NR0B1 Rabbit pAb |
A1740-50ul |
Abclonal |
50 ul |
EUR 223 |
NR0B1 Antibody |
49770-100ul |
SAB |
100ul |
EUR 333 |
NR0B1 Antibody |
49770-50ul |
SAB |
50ul |
EUR 239 |
NR0B1 Antibody |
32408-100ul |
SAB |
100ul |
EUR 252 |
NR0B1 antibody |
20R-NR015 |
Fitzgerald |
50 ug |
EUR 656 |
Description: Rabbit polyclonal NR0B1 antibody |
NR0B1 antibody |
20R-NR016 |
Fitzgerald |
50 ug |
EUR 656 |
Description: Rabbit polyclonal NR0B1 antibody |
NR0B1 antibody |
70R-1932 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NR0B1 antibody raised against the N terminal of NR0B1 |
NR0B1 antibody |
70R-1933 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NR0B1 antibody raised against the middle region of NR0B1 |
NR0B1 antibody |
70R-12882 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal NR0B1 antibody |
NR0B1 antibody |
70R-1004 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal NR0B1 antibody raised against the N terminal of NR0B1 |
NR0B1 Antibody |
DF6585 |
Affbiotech |
200ul |
EUR 304 |
Description: NR0B1 Antibody detects endogenous levels of total NR0B1. |
NR0B1 Antibody |
CSB-PA016041KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NR0B1 Antibody |
CSB-PA016041KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NR0B1 Antibody |
1-CSB-PA016041LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
Polyclonal DAX1 (NR0B1) Antibody (N-term) |
APR11700G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DAX1 (NR0B1) (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Nr0b1 Antibody - C-terminal region |
AMM06803G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nr0b1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-DAX1 / NR0B1 Antibody |
APG03356G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DAX1 / NR0B1 . This antibody is tested and proven to work in the following applications: |
NR0B1 Conjugated Antibody |
C49770 |
SAB |
100ul |
EUR 397 |
NR0B1 Conjugated Antibody |
C32408 |
SAB |
100ul |
EUR 397 |
Anti-NR0B1 antibody |
STJ24807 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that contains a DNA-binding domain. The encoded protein acts as a dominant-negative regulator of transcription which is mediated by the retinoic acid receptor. This protein also functions as an anti-testis gene by acting antagonistically to Sry. Mutations in this gene result in both X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism. |
Anti-NR0B1 antibody |
STJ192082 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NR0B1 |
Polyclonal NR0B1 / DAX1 Antibody (Ligand-binding Domain) |
AMM06801G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR0B1 / DAX1 (Ligand-binding Domain). This antibody is tested and proven to work in the following applications: |
NR0B1 siRNA |
20-abx903638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR0B1 siRNA |
20-abx926313 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR0B1 siRNA |
20-abx926314 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR0B1 Antibody, HRP conjugated |
1-CSB-PA016041LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NR0B1 Antibody, FITC conjugated |
1-CSB-PA016041LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NR0B1 Antibody, Biotin conjugated |
1-CSB-PA016041LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NR0B1 cloning plasmid |
CSB-CL016041HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1413
- Sequence: atggcgggcgagaaccaccagtggcagggcagcatcctctacaacatgcttatgagcgcgaagcaaacgcgcgcggctcctgaggctccagagacgcggctggtggatcagtgctggggctgttcgtgcggcgatgagcccggggtgggcagagaggggctgctgggcgggcgga
- Show more
|
Description: A cloning plasmid for the NR0B1 gene. |
NR0B1 Blocking Peptide |
33R-5660 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1932 |
NR0B1 Blocking Peptide |
33R-2852 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1933 |
NR0B1 Blocking Peptide |
33R-9300 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1004 |
NR0B1 Blocking Peptide |
DF6585-BP |
Affbiotech |
1mg |
EUR 195 |
anti-NR0B1 / Dax1 |
YF-PA10122 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to NR0B1 / Dax1 |
anti-NR0B1 / Dax1 |
YF-PA10123 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NR0B1 / Dax1 |
anti-NR0B1 / Dax1 |
YF-PA23192 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NR0B1 / Dax1 |
Anti-NR0B1 / DAX1 Monoclonal Antibody |
M01521 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal NR0B1 / DAX1 Antibody. Validated in IF, WB and tested in Human. |
Rat NR0B1 shRNA Plasmid |
20-abx985914 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NR0B1 shRNA Plasmid |
20-abx950134 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NR0B1 shRNA Plasmid |
20-abx969086 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NR0B1 Recombinant Protein (Human) |
RP021580 |
ABM |
100 ug |
Ask for price |
NR0B1 Recombinant Protein (Rat) |
RP214424 |
ABM |
100 ug |
Ask for price |
NR0B1 Recombinant Protein (Mouse) |
RP154835 |
ABM |
100 ug |
Ask for price |
Anti-NR0B1 / Dax1 (2F12) |
YF-MA11851 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NR0B1 / Dax1 |
Anti-NR0B1 / Dax1 (1F10) |
YF-MA11852 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to NR0B1 / Dax1 |
Anti-NR0B1 / Dax1 (1F10) |
YF-MA11853 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to NR0B1 / Dax1 |
Anti-NR0B1 / Dax1 (3G8) |
YF-MA11854 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NR0B1 / Dax1 |
Monoclonal NR0B1 Antibody (monoclonal) (M03), Clone: 1F10 |
AMM06802G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human NR0B1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1F10. This antibody is applicable in WB and IF, E |
NR0B1 ORF Vector (Human) (pORF) |
ORF007194 |
ABM |
1.0 ug DNA |
EUR 95 |
h NR0B1 inducible lentiviral particles |
LVP712 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing human target: h NR0B1 (nuclear receptor subfamily 0, group B, member 1), [alternative names: AHC; AHCH; AHX; DAX-1; DAX1; DSS; GTD; HHG; NROB1; SRXY2]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000475. It also contains a RFP-Blasticidin dual selection marker. |
Nr0b1 ORF Vector (Rat) (pORF) |
ORF071476 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr0b1 ORF Vector (Mouse) (pORF) |
ORF051613 |
ABM |
1.0 ug DNA |
EUR 506 |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat) |
4-PAD966Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) |
NR0B1 sgRNA CRISPR Lentivector set (Human) |
K1454001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr0b1 sgRNA CRISPR Lentivector set (Mouse) |
K3397101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr0b1 sgRNA CRISPR Lentivector set (Rat) |
K6849501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), APC |
4-PAD966Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with APC. |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), Biotinylated |
4-PAD966Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with Biotin. |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), Cy3 |
4-PAD966Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with Cy3. |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), FITC |
4-PAD966Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with FITC. |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), HRP |
4-PAD966Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with HRP. |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), PE |
4-PAD966Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with PE. |
Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit |
E04N0562-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit |
E04N0562-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit |
E04N0562-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAD966Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with APC-Cy7. |
NR0B1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1454002 |
ABM |
1.0 ug DNA |
EUR 154 |
NR0B1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1454003 |
ABM |
1.0 ug DNA |
EUR 154 |
NR0B1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1454004 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3397102 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3397103 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3397104 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6849502 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6849503 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6849504 |
ABM |
1.0 ug DNA |
EUR 154 |
NR0B1 Protein Vector (Human) (pPB-C-His) |
PV028773 |
ABM |
500 ng |
EUR 329 |
NR0B1 Protein Vector (Human) (pPB-N-His) |
PV028774 |
ABM |
500 ng |
EUR 329 |
NR0B1 Protein Vector (Human) (pPM-C-HA) |
PV028775 |
ABM |
500 ng |
EUR 329 |
NR0B1 Protein Vector (Human) (pPM-C-His) |
PV028776 |
ABM |
500 ng |
EUR 329 |
NR0B1 Protein Vector (Mouse) (pPB-C-His) |
PV206450 |
ABM |
500 ng |
EUR 603 |
NR0B1 Protein Vector (Mouse) (pPB-N-His) |
PV206451 |
ABM |
500 ng |
EUR 603 |
NR0B1 Protein Vector (Mouse) (pPM-C-HA) |
PV206452 |
ABM |
500 ng |
EUR 603 |
NR0B1 Protein Vector (Mouse) (pPM-C-His) |
PV206453 |
ABM |
500 ng |
EUR 603 |
NR0B1 Protein Vector (Rat) (pPB-C-His) |
PV285902 |
ABM |
500 ng |
EUR 603 |
NR0B1 Protein Vector (Rat) (pPB-N-His) |
PV285903 |
ABM |
500 ng |
EUR 603 |
NR0B1 Protein Vector (Rat) (pPM-C-HA) |
PV285904 |
ABM |
500 ng |
EUR 603 |
NR0B1 Protein Vector (Rat) (pPM-C-His) |
PV285905 |
ABM |
500 ng |
EUR 603 |
Nr0b1 3'UTR GFP Stable Cell Line |
TU164284 |
ABM |
1.0 ml |
Ask for price |
NR0B1 3'UTR Luciferase Stable Cell Line |
TU015960 |
ABM |
1.0 ml |
EUR 1394 |
Nr0b1 3'UTR Luciferase Stable Cell Line |
TU114284 |
ABM |
1.0 ml |
Ask for price |
NR0B1 3'UTR GFP Stable Cell Line |
TU065960 |
ABM |
1.0 ml |
EUR 1394 |
Nr0b1 3'UTR GFP Stable Cell Line |
TU264154 |
ABM |
1.0 ml |
Ask for price |
Nr0b1 3'UTR Luciferase Stable Cell Line |
TU214154 |
ABM |
1.0 ml |
Ask for price |
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
abx117149-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
20-abx001448 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
20-abx177840 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
20-abx177841 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
abx430216-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
20-abx302545 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NR0B1 Rabbit Polyclonal Antibody