NR0B1 Rabbit Polyclonal Antibody
 NR0B1 Polyclonal Antibody |
|
ES10924-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NR0B1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 NR0B1 Rabbit pAb |
|
A1740-100ul |
Abclonal |
100 ul |
EUR 308 |
NR0B1 Rabbit pAb |
|
A1740-200ul |
Abclonal |
200 ul |
EUR 459 |
NR0B1 Rabbit pAb |
|
A1740-20ul |
Abclonal |
20 ul |
EUR 183 |
NR0B1 Rabbit pAb |
|
A1740-50ul |
Abclonal |
50 ul |
EUR 223 |
 NR0B1 antibody |
|
20R-NR015 |
Fitzgerald |
50 ug |
EUR 656 |
|
Description: Rabbit polyclonal NR0B1 antibody |
NR0B1 antibody |
|
20R-NR016 |
Fitzgerald |
50 ug |
EUR 656 |
|
Description: Rabbit polyclonal NR0B1 antibody |
NR0B1 antibody |
|
70R-1932 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal NR0B1 antibody raised against the N terminal of NR0B1 |
NR0B1 antibody |
|
70R-1933 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal NR0B1 antibody raised against the middle region of NR0B1 |
NR0B1 antibody |
|
70R-12882 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal NR0B1 antibody |
NR0B1 antibody |
|
70R-1004 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal NR0B1 antibody raised against the N terminal of NR0B1 |
 NR0B1 Antibody |
|
32408-100ul |
SAB |
100ul |
EUR 252 |
NR0B1 Antibody |
|
49770-100ul |
SAB |
100ul |
EUR 333 |
NR0B1 Antibody |
|
49770-50ul |
SAB |
50ul |
EUR 239 |
NR0B1 Antibody |
|
DF6585 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NR0B1 Antibody detects endogenous levels of total NR0B1. |
NR0B1 Antibody |
|
CSB-PA016041KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NR0B1 Antibody |
|
CSB-PA016041KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NR0B1 Antibody |
|
1-CSB-PA016041LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
 Polyclonal Goat Anti-DAX1 / NR0B1 Antibody |
|
APG03356G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DAX1 / NR0B1 . This antibody is tested and proven to work in the following applications: |
 Polyclonal Nr0b1 Antibody - C-terminal region |
|
AMM06803G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nr0b1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 Antibody (N-term)) Polyclonal DAX1 (NR0B1) Antibody (N-term) |
|
APR11700G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DAX1 (NR0B1) (N-term). This antibody is tested and proven to work in the following applications: |
 NR0B1 Conjugated Antibody |
|
C49770 |
SAB |
100ul |
EUR 397 |
NR0B1 Conjugated Antibody |
|
C32408 |
SAB |
100ul |
EUR 397 |
 Anti-NR0B1 antibody |
|
STJ24807 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a protein that contains a DNA-binding domain. The encoded protein acts as a dominant-negative regulator of transcription which is mediated by the retinoic acid receptor. This protein also functions as an anti-testis gene by acting antagonistically to Sry. Mutations in this gene result in both X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism. |
Anti-NR0B1 antibody |
|
STJ192082 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NR0B1 |
) Polyclonal NR0B1 / DAX1 Antibody (Ligand-binding Domain) |
|
AMM06801G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR0B1 / DAX1 (Ligand-binding Domain). This antibody is tested and proven to work in the following applications: |
 NR0B1 siRNA |
|
20-abx903638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR0B1 siRNA |
|
20-abx926313 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR0B1 siRNA |
|
20-abx926314 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 NR0B1 Antibody, HRP conjugated |
|
1-CSB-PA016041LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 NR0B1 Antibody, FITC conjugated |
|
1-CSB-PA016041LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 NR0B1 Antibody, Biotin conjugated |
|
1-CSB-PA016041LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 NR0B1 Blocking Peptide |
|
33R-2852 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1933 |
NR0B1 Blocking Peptide |
|
33R-5660 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1932 |
NR0B1 Blocking Peptide |
|
33R-9300 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1004 |
NR0B1 Blocking Peptide |
|
DF6585-BP |
Affbiotech |
1mg |
EUR 195 |
 NR0B1 cloning plasmid |
|
CSB-CL016041HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1413
- Sequence: atggcgggcgagaaccaccagtggcagggcagcatcctctacaacatgcttatgagcgcgaagcaaacgcgcgcggctcctgaggctccagagacgcggctggtggatcagtgctggggctgttcgtgcggcgatgagcccggggtgggcagagaggggctgctgggcgggcgga
- Show more
|
|
Description: A cloning plasmid for the NR0B1 gene. |
 anti-NR0B1 / Dax1 |
|
YF-PA10122 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to NR0B1 / Dax1 |
anti-NR0B1 / Dax1 |
|
YF-PA10123 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to NR0B1 / Dax1 |
anti-NR0B1 / Dax1 |
|
YF-PA23192 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to NR0B1 / Dax1 |
 Anti-NR0B1 / DAX1 Monoclonal Antibody |
|
M01521 |
BosterBio |
100ug |
EUR 397 |
|
Description: Rabbit Monoclonal NR0B1 / DAX1 Antibody. Validated in IF, WB and tested in Human. |
 Rat NR0B1 shRNA Plasmid |
|
20-abx985914 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NR0B1 shRNA Plasmid |
|
20-abx950134 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse NR0B1 shRNA Plasmid |
|
20-abx969086 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NR0B1 Recombinant Protein (Human) |
|
RP021580 |
ABM |
100 ug |
Ask for price |
) NR0B1 Recombinant Protein (Mouse) |
|
RP154835 |
ABM |
100 ug |
Ask for price |
) NR0B1 Recombinant Protein (Rat) |
|
RP214424 |
ABM |
100 ug |
Ask for price |
) Anti-NR0B1 / Dax1 (2F12) |
|
YF-MA11851 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NR0B1 / Dax1 |
) Anti-NR0B1 / Dax1 (1F10) |
|
YF-MA11852 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse monoclonal to NR0B1 / Dax1 |
Anti-NR0B1 / Dax1 (1F10) |
|
YF-MA11853 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to NR0B1 / Dax1 |
) Anti-NR0B1 / Dax1 (3G8) |
|
YF-MA11854 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NR0B1 / Dax1 |
 (M03), Clone: 1F10) Monoclonal NR0B1 Antibody (monoclonal) (M03), Clone: 1F10 |
|
AMM06802G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NR0B1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1F10. This antibody is applicable in WB and IF, E |
 (pORF)) Nr0b1 ORF Vector (Rat) (pORF) |
|
ORF071476 |
ABM |
1.0 ug DNA |
EUR 506 |
 h NR0B1 inducible lentiviral particles |
|
LVP712 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
|
Description: Pre-made over-expression lentivirus for expressing human target: h NR0B1 (nuclear receptor subfamily 0, group B, member 1), [alternative names: AHC; AHCH; AHX; DAX-1; DAX1; DSS; GTD; HHG; NROB1; SRXY2]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000475. It also contains a RFP-Blasticidin dual selection marker. |
 (pORF)) NR0B1 ORF Vector (Human) (pORF) |
|
ORF007194 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nr0b1 ORF Vector (Mouse) (pORF) |
|
ORF051613 |
ABM |
1.0 ug DNA |
EUR 506 |
 Polyclonal Antibody (Rat)) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat) |
|
4-PAD966Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) |
) Nr0b1 sgRNA CRISPR Lentivector set (Rat) |
|
K6849501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nr0b1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3397101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) NR0B1 sgRNA CRISPR Lentivector set (Human) |
|
K1454001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Polyclonal Antibody (Rat), APC) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), APC |
|
4-PAD966Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with APC. |
 Polyclonal Antibody (Rat), Biotinylated) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), Biotinylated |
|
4-PAD966Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Rat), Cy3) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), Cy3 |
|
4-PAD966Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Rat), FITC) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), FITC |
|
4-PAD966Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Rat), HRP) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), HRP |
|
4-PAD966Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Rat), PE) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), PE |
|
4-PAD966Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with PE. |
 ELISA kit) Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit |
|
E04N0562-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit |
|
E04N0562-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit |
|
E04N0562-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Polyclonal Antibody (Rat), APC-Cy7) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), APC-Cy7 |
|
4-PAD966Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with APC-Cy7. |
 (Target 1)) Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6849502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6849503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6849504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3397102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3397103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3397104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) NR0B1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1454002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NR0B1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1454003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NR0B1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1454004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NR0B1 Protein Vector (Rat) (pPB-C-His) |
|
PV285902 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NR0B1 Protein Vector (Rat) (pPB-N-His) |
|
PV285903 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NR0B1 Protein Vector (Rat) (pPM-C-HA) |
|
PV285904 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NR0B1 Protein Vector (Rat) (pPM-C-His) |
|
PV285905 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NR0B1 Protein Vector (Mouse) (pPB-C-His) |
|
PV206450 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NR0B1 Protein Vector (Mouse) (pPB-N-His) |
|
PV206451 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NR0B1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV206452 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NR0B1 Protein Vector (Mouse) (pPM-C-His) |
|
PV206453 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NR0B1 Protein Vector (Human) (pPB-C-His) |
|
PV028773 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NR0B1 Protein Vector (Human) (pPB-N-His) |
|
PV028774 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NR0B1 Protein Vector (Human) (pPM-C-HA) |
|
PV028775 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NR0B1 Protein Vector (Human) (pPM-C-His) |
|
PV028776 |
ABM |
500 ng |
EUR 329 |
 Nr0b1 3'UTR Luciferase Stable Cell Line |
|
TU114284 |
ABM |
1.0 ml |
Ask for price |
 Nr0b1 3'UTR GFP Stable Cell Line |
|
TU164284 |
ABM |
1.0 ml |
Ask for price |
Nr0b1 3'UTR Luciferase Stable Cell Line |
|
TU214154 |
ABM |
1.0 ml |
Ask for price |
Nr0b1 3'UTR GFP Stable Cell Line |
|
TU264154 |
ABM |
1.0 ml |
Ask for price |
 NR0B1 3'UTR GFP Stable Cell Line |
|
TU065960 |
ABM |
1.0 ml |
EUR 1394 |
 NR0B1 3'UTR Luciferase Stable Cell Line |
|
TU015960 |
ABM |
1.0 ml |
EUR 1394 |
 Antibody) Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
|
20-abx177840 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
|
20-abx177841 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
|
abx117149-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
|
abx430216-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
|
20-abx302545 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody |
|
20-abx001448 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
 MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
NR0B1 Rabbit Polyclonal Antibody
