NR0B1 Rabbit Polyclonal Antibody

NR0B1 Rabbit Polyclonal Antibody

NR0B1 Polyclonal Antibody

ABP59519-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR0B1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NR0B1 from Human. This NR0B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR0B1 protein

NR0B1 Rabbit pAb

A1740-100ul 100 ul
EUR 308

NR0B1 Rabbit pAb

A1740-200ul 200 ul
EUR 459

NR0B1 Rabbit pAb

A1740-20ul 20 ul
EUR 183

NR0B1 Rabbit pAb

A1740-50ul 50 ul
EUR 223

NR0B1 Antibody

ABD6585 100 ug
EUR 438

NR0B1 Antibody

49770-100ul 100ul
EUR 333

NR0B1 Antibody

49770-50ul 50ul
EUR 239

NR0B1 Antibody

32408-100ul 100ul
EUR 252

NR0B1 antibody

20R-NR015 50 ug
EUR 656
Description: Rabbit polyclonal NR0B1 antibody

NR0B1 antibody

20R-NR016 50 ug
EUR 656
Description: Rabbit polyclonal NR0B1 antibody

NR0B1 antibody

70R-1932 50 ug
EUR 467
Description: Rabbit polyclonal NR0B1 antibody raised against the N terminal of NR0B1

NR0B1 antibody

70R-1933 50 ug
EUR 467
Description: Rabbit polyclonal NR0B1 antibody raised against the middle region of NR0B1

NR0B1 antibody

70R-12882 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal NR0B1 antibody

NR0B1 antibody

70R-1004 100 ug
EUR 377
Description: Rabbit polyclonal NR0B1 antibody raised against the N terminal of NR0B1

NR0B1 Antibody

DF6585 200ul
EUR 304
Description: NR0B1 Antibody detects endogenous levels of total NR0B1.

NR0B1 Antibody

CSB-PA016041KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NR0B1 Antibody

CSB-PA016041KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NR0B1 Antibody

1-CSB-PA016041LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

Polyclonal DAX1 (NR0B1) Antibody (N-term)

APR11700G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DAX1 (NR0B1) (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Nr0b1 Antibody - C-terminal region

AMM06803G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nr0b1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-DAX1 / NR0B1 Antibody

APG03356G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DAX1 / NR0B1 . This antibody is tested and proven to work in the following applications:

NR0B1 Conjugated Antibody

C49770 100ul
EUR 397

NR0B1 Conjugated Antibody

C32408 100ul
EUR 397

Anti-NR0B1 antibody

STJ24807 100 µl
EUR 277
Description: This gene encodes a protein that contains a DNA-binding domain. The encoded protein acts as a dominant-negative regulator of transcription which is mediated by the retinoic acid receptor. This protein also functions as an anti-testis gene by acting antagonistically to Sry. Mutations in this gene result in both X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism.

Anti-NR0B1 antibody

STJ192082 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR0B1

Nr0b1/ Rat Nr0b1 ELISA Kit

ELI-13741r 96 Tests
EUR 886

Polyclonal NR0B1 / DAX1 Antibody (Ligand-binding Domain)

AMM06801G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NR0B1 / DAX1 (Ligand-binding Domain). This antibody is tested and proven to work in the following applications:

NR0B1 siRNA

20-abx903638
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR0B1 siRNA

20-abx926313
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR0B1 siRNA

20-abx926314
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR0B1 Antibody, HRP conjugated

1-CSB-PA016041LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NR0B1 Antibody, FITC conjugated

1-CSB-PA016041LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NR0B1 Antibody, Biotin conjugated

1-CSB-PA016041LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR0B1. Recognizes NR0B1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-DAX1 / NR0B1 antibody

STJ71175 100 µg
EUR 359

NR0B1 cloning plasmid

CSB-CL016041HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atggcgggcgagaaccaccagtggcagggcagcatcctctacaacatgcttatgagcgcgaagcaaacgcgcgcggctcctgaggctccagagacgcggctggtggatcagtgctggggctgttcgtgcggcgatgagcccggggtgggcagagaggggctgctgggcgggcgga
  • Show more
Description: A cloning plasmid for the NR0B1 gene.

NR0B1 Blocking Peptide

33R-5660 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1932

NR0B1 Blocking Peptide

33R-2852 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1933

NR0B1 Blocking Peptide

33R-9300 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B1 antibody, catalog no. 70R-1004

NR0B1 Blocking Peptide

DF6585-BP 1mg
EUR 195

anti-NR0B1 / Dax1

YF-PA10122 50 ul
EUR 363
Description: Mouse polyclonal to NR0B1 / Dax1

anti-NR0B1 / Dax1

YF-PA10123 100 ug
EUR 403
Description: Rabbit polyclonal to NR0B1 / Dax1

anti-NR0B1 / Dax1

YF-PA23192 50 ul
EUR 334
Description: Mouse polyclonal to NR0B1 / Dax1

Anti-NR0B1 / DAX1 Monoclonal Antibody

M01521 100ug
EUR 397
Description: Rabbit Monoclonal NR0B1 / DAX1 Antibody. Validated in IF, WB and tested in Human.

Rat NR0B1 shRNA Plasmid

20-abx985914
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Nr0b1 ELISA KIT

ELI-13740m 96 Tests
EUR 865

Human NR0B1 ELISA KIT

ELI-22253h 96 Tests
EUR 824

Human NR0B1 shRNA Plasmid

20-abx950134
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NR0B1 shRNA Plasmid

20-abx969086
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR0B1 Recombinant Protein (Human)

RP021580 100 ug Ask for price

NR0B1 Recombinant Protein (Rat)

RP214424 100 ug Ask for price

NR0B1 Recombinant Protein (Mouse)

RP154835 100 ug Ask for price

Anti-NR0B1 / Dax1 (2F12)

YF-MA11851 100 ug
EUR 363
Description: Mouse monoclonal to NR0B1 / Dax1

Anti-NR0B1 / Dax1 (1F10)

YF-MA11852 50 ug
EUR 363
Description: Mouse monoclonal to NR0B1 / Dax1

Anti-NR0B1 / Dax1 (1F10)

YF-MA11853 200 ul
EUR 363
Description: Mouse monoclonal to NR0B1 / Dax1

Anti-NR0B1 / Dax1 (3G8)

YF-MA11854 100 ug
EUR 363
Description: Mouse monoclonal to NR0B1 / Dax1

Monoclonal NR0B1 Antibody (monoclonal) (M03), Clone: 1F10

AMM06802G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human NR0B1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1F10. This antibody is applicable in WB and IF, E

NR0B1 ORF Vector (Human) (pORF)

ORF007194 1.0 ug DNA
EUR 95

h NR0B1 inducible lentiviral particles

LVP712 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h NR0B1 (nuclear receptor subfamily 0, group B, member 1), [alternative names: AHC; AHCH; AHX; DAX-1; DAX1; DSS; GTD; HHG; NROB1; SRXY2]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000475. It also contains a RFP-Blasticidin dual selection marker.

Nr0b1 ORF Vector (Rat) (pORF)

ORF071476 1.0 ug DNA
EUR 506

Nr0b1 ORF Vector (Mouse) (pORF)

ORF051613 1.0 ug DNA
EUR 506

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat)

4-PAD966Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1)

NR0B1 sgRNA CRISPR Lentivector set (Human)

K1454001 3 x 1.0 ug
EUR 339

Nr0b1 sgRNA CRISPR Lentivector set (Mouse)

K3397101 3 x 1.0 ug
EUR 339

Nr0b1 sgRNA CRISPR Lentivector set (Rat)

K6849501 3 x 1.0 ug
EUR 339

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), APC

4-PAD966Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with APC.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), Biotinylated

4-PAD966Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with Biotin.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), Cy3

4-PAD966Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with Cy3.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), FITC

4-PAD966Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with FITC.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), HRP

4-PAD966Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with HRP.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), PE

4-PAD966Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with PE.

Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit

E04N0562-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit

E04N0562-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) ELISA kit

E04N0562-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Nuclear receptor subfamily 0 group B member 1(NR0B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Polyclonal Antibody (Rat), APC-Cy7

4-PAD966Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1). This antibody is labeled with APC-Cy7.

NR0B1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1454002 1.0 ug DNA
EUR 154

NR0B1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1454003 1.0 ug DNA
EUR 154

NR0B1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1454004 1.0 ug DNA
EUR 154

Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3397102 1.0 ug DNA
EUR 154

Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3397103 1.0 ug DNA
EUR 154

Nr0b1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3397104 1.0 ug DNA
EUR 154

Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6849502 1.0 ug DNA
EUR 154

Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6849503 1.0 ug DNA
EUR 154

Nr0b1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6849504 1.0 ug DNA
EUR 154

NR0B1 Protein Vector (Human) (pPB-C-His)

PV028773 500 ng
EUR 329

NR0B1 Protein Vector (Human) (pPB-N-His)

PV028774 500 ng
EUR 329

NR0B1 Protein Vector (Human) (pPM-C-HA)

PV028775 500 ng
EUR 329

NR0B1 Protein Vector (Human) (pPM-C-His)

PV028776 500 ng
EUR 329

NR0B1 Protein Vector (Mouse) (pPB-C-His)

PV206450 500 ng
EUR 603

NR0B1 Protein Vector (Mouse) (pPB-N-His)

PV206451 500 ng
EUR 603

NR0B1 Protein Vector (Mouse) (pPM-C-HA)

PV206452 500 ng
EUR 603

NR0B1 Protein Vector (Mouse) (pPM-C-His)

PV206453 500 ng
EUR 603

NR0B1 Protein Vector (Rat) (pPB-C-His)

PV285902 500 ng
EUR 603

NR0B1 Protein Vector (Rat) (pPB-N-His)

PV285903 500 ng
EUR 603

NR0B1 Protein Vector (Rat) (pPM-C-HA)

PV285904 500 ng
EUR 603

NR0B1 Protein Vector (Rat) (pPM-C-His)

PV285905 500 ng
EUR 603

Nr0b1 3'UTR GFP Stable Cell Line

TU164284 1.0 ml Ask for price

NR0B1 3'UTR Luciferase Stable Cell Line

TU015960 1.0 ml
EUR 1394

Nr0b1 3'UTR Luciferase Stable Cell Line

TU114284 1.0 ml Ask for price

NR0B1 3'UTR GFP Stable Cell Line

TU065960 1.0 ml
EUR 1394

Nr0b1 3'UTR GFP Stable Cell Line

TU264154 1.0 ml Ask for price

Nr0b1 3'UTR Luciferase Stable Cell Line

TU214154 1.0 ml Ask for price

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody

abx117149-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody

20-abx001448
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody

20-abx177840
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody

20-abx177841
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody

abx430216-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Nuclear Receptor Subfamily 0, Group B, Member 1 (NR0B1) Antibody

20-abx302545
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NR0B1 Rabbit Polyclonal Antibody