NUAK2 Rabbit Polyclonal Antibody
NUAK2 Polyclonal Antibody |
ABP59558-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NUAK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NUAK2 from Human. This NUAK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NUAK2 protein |
NUAK2 Rabbit pAb |
A1079-100ul |
Abclonal |
100 ul |
EUR 308 |
NUAK2 Rabbit pAb |
A1079-200ul |
Abclonal |
200 ul |
EUR 459 |
NUAK2 Rabbit pAb |
A1079-20ul |
Abclonal |
20 ul |
EUR 183 |
NUAK2 Rabbit pAb |
A1079-50ul |
Abclonal |
50 ul |
EUR 223 |
NUAK2 antibody |
38178-100ul |
SAB |
100ul |
EUR 252 |
NUAK2 antibody |
70R-18980 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NUAK2 antibody |
NUAK2 Antibody |
DF6224 |
Affbiotech |
200ul |
EUR 304 |
Description: NUAK2 Antibody detects endogenous levels of total NUAK2. |
NUAK2 Antibody |
1-CSB-PA880931ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NUAK2. Recognizes NUAK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NUAK2 Antibody |
DF2671 |
Affbiotech |
200ul |
EUR 304 |
Description: NUAK2 antibody detects endogenous levels of total NUAK2. |
NUAK2 Antibody |
1-CSB-PA016140GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NUAK2. Recognizes NUAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
NUAK2 Conjugated Antibody |
C38178 |
SAB |
100ul |
EUR 397 |
anti- NUAK2 antibody |
FNab05886 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: NUAK family, SNF1-like kinase, 2
- Uniprot ID: Q9H093
- Gene ID: 81788
- Research Area: Metabolism
|
Description: Antibody raised against NUAK2 |
Anti-NUAK2 antibody |
STJ191977 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NUAK2 |
NUAK2 siRNA |
20-abx903682 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NUAK2 siRNA |
20-abx926534 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NUAK2 siRNA |
20-abx926535 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NUAK2 |
YF-PA21180 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NUAK2 |
NUAK2 cloning plasmid |
CSB-CL880931HU-10ug |
Cusabio |
10ug |
EUR 637 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1887
- Sequence: atggagtcgctggttttcgcgcggcgctccggccccactccctcggccgcagagctagcccggccgctggcggaagggctgatcaagtcgcccaagcccctaatgaagaagcaggcggtgaagcggcaccaccacaagcacaacctgcggcaccgctacgagttcctggagaccc
- Show more
|
Description: A cloning plasmid for the NUAK2 gene. |
NUAK2 Blocking Peptide |
DF6224-BP |
Affbiotech |
1mg |
EUR 195 |
NUAK2 Blocking Peptide |
DF2671-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-NUAK2 (2F9) |
YF-MA19454 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NUAK2 |
Mouse NUAK2 shRNA Plasmid |
20-abx978108 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NUAK2 shRNA Plasmid |
20-abx988388 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NUAK2 shRNA Plasmid |
20-abx963047 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NUAK Family Kinase 2 (NUAK2) Antibody |
abx122644-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
NUAK Family Kinase 2 (NUAK2) Antibody |
20-abx001002 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
NUAK Family Kinase 2 (NUAK2) Antibody |
20-abx321013 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NUAK Family Kinase 2 (NUAK2) Antibody |
abx235886-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NUAK2 ORF Vector (Human) (pORF) |
ORF007266 |
ABM |
1.0 ug DNA |
EUR 95 |
h NUAK2 inducible lentiviral particles |
LVP047 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NUAK2, is fully sequence verified and matched to NCBI accession ID: NM_030952.1 |
Nuak2 ORF Vector (Rat) (pORF) |
ORF071578 |
ABM |
1.0 ug DNA |
EUR 506 |
Nuak2 ORF Vector (Mouse) (pORF) |
ORF051772 |
ABM |
1.0 ug DNA |
EUR 506 |
Nuak2 ORF Vector (Mouse) (pORF) |
ORF051773 |
ABM |
1.0 ug DNA |
EUR 506 |
NUAK2 sgRNA CRISPR Lentivector set (Human) |
K1462601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nuak2 sgRNA CRISPR Lentivector set (Rat) |
K7411501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nuak2 sgRNA CRISPR Lentivector set (Mouse) |
K4922201 |
ABM |
3 x 1.0 ug |
EUR 339 |
NUAK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1462602 |
ABM |
1.0 ug DNA |
EUR 154 |
NUAK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1462603 |
ABM |
1.0 ug DNA |
EUR 154 |
NUAK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1462604 |
ABM |
1.0 ug DNA |
EUR 154 |
Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7411502 |
ABM |
1.0 ug DNA |
EUR 154 |
Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7411503 |
ABM |
1.0 ug DNA |
EUR 154 |
Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7411504 |
ABM |
1.0 ug DNA |
EUR 154 |
Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4922202 |
ABM |
1.0 ug DNA |
EUR 154 |
Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4922203 |
ABM |
1.0 ug DNA |
EUR 154 |
Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4922204 |
ABM |
1.0 ug DNA |
EUR 154 |
NUAK2 Protein Vector (Human) (pPB-C-His) |
PV029061 |
ABM |
500 ng |
EUR 329 |
NUAK2 Protein Vector (Human) (pPB-N-His) |
PV029062 |
ABM |
500 ng |
EUR 329 |
NUAK2 Protein Vector (Human) (pPM-C-HA) |
PV029063 |
ABM |
500 ng |
EUR 329 |
NUAK2 Protein Vector (Human) (pPM-C-His) |
PV029064 |
ABM |
500 ng |
EUR 329 |
NUAK2 Protein Vector (Mouse) (pPB-C-His) |
PV207086 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Mouse) (pPB-N-His) |
PV207087 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Mouse) (pPM-C-HA) |
PV207088 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Mouse) (pPM-C-His) |
PV207089 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Mouse) (pPB-C-His) |
PV207090 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Mouse) (pPB-N-His) |
PV207091 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Mouse) (pPM-C-HA) |
PV207092 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Mouse) (pPM-C-His) |
PV207093 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Rat) (pPB-C-His) |
PV286310 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Rat) (pPB-N-His) |
PV286311 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Rat) (pPM-C-HA) |
PV286312 |
ABM |
500 ng |
EUR 603 |
NUAK2 Protein Vector (Rat) (pPM-C-His) |
PV286313 |
ABM |
500 ng |
EUR 603 |
Nuak2 3'UTR GFP Stable Cell Line |
TU164389 |
ABM |
1.0 ml |
Ask for price |
NUAK2 3'UTR Luciferase Stable Cell Line |
TU016047 |
ABM |
1.0 ml |
EUR 1394 |
Nuak2 3'UTR Luciferase Stable Cell Line |
TU114389 |
ABM |
1.0 ml |
Ask for price |
NUAK2 3'UTR GFP Stable Cell Line |
TU066047 |
ABM |
1.0 ml |
EUR 1394 |
Nuak2 3'UTR GFP Stable Cell Line |
TU264254 |
ABM |
1.0 ml |
Ask for price |
Nuak2 3'UTR Luciferase Stable Cell Line |
TU214254 |
ABM |
1.0 ml |
Ask for price |
Human NUAK Family Kinase 2 (NUAK2) ELISA Kit |
abx381903-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
NUAK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV663709 |
ABM |
1.0 ug DNA |
EUR 682 |
NUAK2 Rabbit Polyclonal Antibody