Da vinci european bio bank

NUAK2 Rabbit Polyclonal Antibody

NUAK2 Polyclonal Antibody
ES10819-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NUAK2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NUAK2 Rabbit pAb
A1079-100ul	Abclonal	100 ul	EUR 308

NUAK2 Rabbit pAb
A1079-200ul	Abclonal	200 ul	EUR 459

NUAK2 Rabbit pAb
A1079-20ul	Abclonal	20 ul	EUR 183

NUAK2 Rabbit pAb
A1079-50ul	Abclonal	50 ul	EUR 223

NUAK2 antibody
70R-18980	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NUAK2 antibody

NUAK2 antibody
38178-100ul	SAB	100ul	EUR 252

NUAK2 Antibody
1-CSB-PA880931ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NUAK2. Recognizes NUAK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NUAK2 Antibody
DF2671	Affbiotech	200ul	EUR 304
Description: NUAK2 antibody detects endogenous levels of total NUAK2.

NUAK2 Antibody
DF6224	Affbiotech	200ul	EUR 304
Description: NUAK2 Antibody detects endogenous levels of total NUAK2.

NUAK2 Antibody
1-CSB-PA016140GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUAK2. Recognizes NUAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

NUAK2 Antibody
ABD2671	Lifescience Market	100 ug	EUR 438

NUAK2 Antibody
ABD6224	Lifescience Market	100 ug	EUR 438

Nuak2/ Rat Nuak2 ELISA Kit
ELI-13376r	Lifescience Market	96 Tests	EUR 886

NUAK2 Conjugated Antibody
C38178	SAB	100ul	EUR 397

anti- NUAK2 antibody
FNab05886	FN Test	100µg	EUR 505.25
Immunogen: NUAK family, SNF1-like kinase, 2 Uniprot ID: Q9H093 Gene ID: 81788 Research Area: Metabolism
Description: Antibody raised against NUAK2

Anti-NUAK2 antibody
PAab05886	Lifescience Market	100 ug	EUR 355

Anti-NUAK2 antibody
STJ24842	St John's Laboratory	100 µl	EUR 277

Anti-NUAK2 antibody
STJ191977	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NUAK2

NUAK2 siRNA
20-abx903682	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUAK2 siRNA
20-abx926534	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUAK2 siRNA
20-abx926535	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NUAK2
YF-PA21180	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NUAK2

NUAK2 Blocking Peptide
DF2671-BP	Affbiotech	1mg	EUR 195

NUAK2 Blocking Peptide
DF6224-BP	Affbiotech	1mg	EUR 195

NUAK2 cloning plasmid
CSB-CL880931HU-10ug	Cusabio	10ug	EUR 637
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1887 Sequence: atggagtcgctggttttcgcgcggcgctccggccccactccctcggccgcagagctagcccggccgctggcggaagggctgatcaagtcgcccaagcccctaatgaagaagcaggcggtgaagcggcaccaccacaagcacaacctgcggcaccgctacgagttcctggagaccc Show more
Description: A cloning plasmid for the NUAK2 gene.

Anti-NUAK2 (2F9)
YF-MA19454	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NUAK2

NUAK2 ELISA KIT|Human
EF001354	Lifescience Market	96 Tests	EUR 689

Rat NUAK2 shRNA Plasmid
20-abx988388	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NUAK2 shRNA Plasmid
20-abx978108	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NUAK2 shRNA Plasmid
20-abx963047	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NUAK Family Kinase 2 (NUAK2) Antibody
abx122644-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

NUAK Family Kinase 2 (NUAK2) Antibody
20-abx321013	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

NUAK Family Kinase 2 (NUAK2) Antibody
abx235886-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

NUAK Family Kinase 2 (NUAK2) Antibody
20-abx001002	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Nuak2 ORF Vector (Rat) (pORF)
ORF071578	ABM	1.0 ug DNA	EUR 506

h NUAK2 inducible lentiviral particles
LVP047	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NUAK2, is fully sequence verified and matched to NCBI accession ID: NM_030952.1

NUAK2 ORF Vector (Human) (pORF)
ORF007266	ABM	1.0 ug DNA	EUR 95

Nuak2 ORF Vector (Mouse) (pORF)
ORF051772	ABM	1.0 ug DNA	EUR 506

Nuak2 ORF Vector (Mouse) (pORF)
ORF051773	ABM	1.0 ug DNA	EUR 506

Nuak2 sgRNA CRISPR Lentivector set (Mouse)
K4922201	ABM	3 x 1.0 ug	EUR 339

Nuak2 sgRNA CRISPR Lentivector set (Rat)
K7411501	ABM	3 x 1.0 ug	EUR 339

NUAK2 sgRNA CRISPR Lentivector set (Human)
K1462601	ABM	3 x 1.0 ug	EUR 339

Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4922202	ABM	1.0 ug DNA	EUR 154

Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4922203	ABM	1.0 ug DNA	EUR 154

Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4922204	ABM	1.0 ug DNA	EUR 154

Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7411502	ABM	1.0 ug DNA	EUR 154

Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7411503	ABM	1.0 ug DNA	EUR 154

Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7411504	ABM	1.0 ug DNA	EUR 154

NUAK2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1462602	ABM	1.0 ug DNA	EUR 154

NUAK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1462603	ABM	1.0 ug DNA	EUR 154

NUAK2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1462604	ABM	1.0 ug DNA	EUR 154

NUAK2 Protein Vector (Rat) (pPB-C-His)
PV286310	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Rat) (pPB-N-His)
PV286311	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Rat) (pPM-C-HA)
PV286312	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Rat) (pPM-C-His)
PV286313	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPB-C-His)
PV207086	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPB-N-His)
PV207087	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-HA)
PV207088	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-His)
PV207089	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPB-C-His)
PV207090	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPB-N-His)
PV207091	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-HA)
PV207092	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-His)
PV207093	ABM	500 ng	EUR 603

NUAK2 Protein Vector (Human) (pPB-C-His)
PV029061	ABM	500 ng	EUR 329

NUAK2 Protein Vector (Human) (pPB-N-His)
PV029062	ABM	500 ng	EUR 329

NUAK2 Protein Vector (Human) (pPM-C-HA)
PV029063	ABM	500 ng	EUR 329

NUAK2 Protein Vector (Human) (pPM-C-His)
PV029064	ABM	500 ng	EUR 329

Nuak2 3'UTR Luciferase Stable Cell Line
TU114389	ABM	1.0 ml	Ask for price

Nuak2 3'UTR GFP Stable Cell Line
TU164389	ABM	1.0 ml	Ask for price

Nuak2 3'UTR Luciferase Stable Cell Line
TU214254	ABM	1.0 ml	Ask for price

Nuak2 3'UTR GFP Stable Cell Line
TU264254	ABM	1.0 ml	Ask for price

NUAK2 3'UTR GFP Stable Cell Line
TU066047	ABM	1.0 ml	EUR 1394

NUAK2 3'UTR Luciferase Stable Cell Line
TU016047	ABM	1.0 ml	EUR 1394

Human NUAK Family Kinase 2 (NUAK2) ELISA Kit
abx381903-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NUAK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV663709	ABM	1.0 ug DNA	EUR 682

NUAK2 Rabbit Polyclonal Antibody