NUAK2 Rabbit Polyclonal Antibody

NUAK2 Rabbit Polyclonal Antibody

NUAK2 Polyclonal Antibody

ABP59558-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NUAK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NUAK2 from Human. This NUAK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NUAK2 protein

NUAK2 Rabbit pAb

A1079-100ul 100 ul
EUR 308

NUAK2 Rabbit pAb

A1079-200ul 200 ul
EUR 459

NUAK2 Rabbit pAb

A1079-20ul 20 ul
EUR 183

NUAK2 Rabbit pAb

A1079-50ul 50 ul
EUR 223

NUAK2 Antibody

ABD2671 100 ug
EUR 438

NUAK2 Antibody

ABD6224 100 ug
EUR 438

NUAK2 antibody

38178-100ul 100ul
EUR 252

NUAK2 antibody

70R-18980 50 ul
EUR 435
Description: Rabbit polyclonal NUAK2 antibody

NUAK2 Antibody

DF6224 200ul
EUR 304
Description: NUAK2 Antibody detects endogenous levels of total NUAK2.

NUAK2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NUAK2. Recognizes NUAK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NUAK2 Antibody

DF2671 200ul
EUR 304
Description: NUAK2 antibody detects endogenous levels of total NUAK2.

NUAK2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUAK2. Recognizes NUAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Nuak2/ Rat Nuak2 ELISA Kit

ELI-13376r 96 Tests
EUR 886

NUAK2 Conjugated Antibody

C38178 100ul
EUR 397

anti- NUAK2 antibody

FNab05886 100µg
EUR 505.25
  • Immunogen: NUAK family, SNF1-like kinase, 2
  • Uniprot ID: Q9H093
  • Gene ID: 81788
  • Research Area: Metabolism
Description: Antibody raised against NUAK2

Anti-NUAK2 antibody

PAab05886 100 ug
EUR 355

Anti-NUAK2 antibody

STJ24842 100 µl
EUR 277

Anti-NUAK2 antibody

STJ191977 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NUAK2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21180 50 ug
EUR 363
Description: Mouse polyclonal to NUAK2

NUAK2 cloning plasmid

CSB-CL880931HU-10ug 10ug
EUR 637
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1887
  • Sequence: atggagtcgctggttttcgcgcggcgctccggccccactccctcggccgcagagctagcccggccgctggcggaagggctgatcaagtcgcccaagcccctaatgaagaagcaggcggtgaagcggcaccaccacaagcacaacctgcggcaccgctacgagttcctggagaccc
  • Show more
Description: A cloning plasmid for the NUAK2 gene.

NUAK2 Blocking Peptide

DF6224-BP 1mg
EUR 195

NUAK2 Blocking Peptide

DF2671-BP 1mg
EUR 195

Anti-NUAK2 (2F9)

YF-MA19454 100 ug
EUR 363
Description: Mouse monoclonal to NUAK2

Mouse NUAK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NUAK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NUAK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001354 96 Tests
EUR 689

NUAK Family Kinase 2 (NUAK2) Antibody

abx122644-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NUAK Family Kinase 2 (NUAK2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NUAK Family Kinase 2 (NUAK2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NUAK Family Kinase 2 (NUAK2) Antibody

abx235886-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NUAK2 ORF Vector (Human) (pORF)

ORF007266 1.0 ug DNA
EUR 95

h NUAK2 inducible lentiviral particles

LVP047 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NUAK2, is fully sequence verified and matched to NCBI accession ID: NM_030952.1

Nuak2 ORF Vector (Rat) (pORF)

ORF071578 1.0 ug DNA
EUR 506

Nuak2 ORF Vector (Mouse) (pORF)

ORF051772 1.0 ug DNA
EUR 506

Nuak2 ORF Vector (Mouse) (pORF)

ORF051773 1.0 ug DNA
EUR 506

NUAK2 sgRNA CRISPR Lentivector set (Human)

K1462601 3 x 1.0 ug
EUR 339

Nuak2 sgRNA CRISPR Lentivector set (Rat)

K7411501 3 x 1.0 ug
EUR 339

Nuak2 sgRNA CRISPR Lentivector set (Mouse)

K4922201 3 x 1.0 ug
EUR 339

NUAK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1462602 1.0 ug DNA
EUR 154

NUAK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1462603 1.0 ug DNA
EUR 154

NUAK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1462604 1.0 ug DNA
EUR 154

Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7411502 1.0 ug DNA
EUR 154

Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7411503 1.0 ug DNA
EUR 154

Nuak2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7411504 1.0 ug DNA
EUR 154

Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4922202 1.0 ug DNA
EUR 154

Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4922203 1.0 ug DNA
EUR 154

Nuak2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4922204 1.0 ug DNA
EUR 154

NUAK2 Protein Vector (Human) (pPB-C-His)

PV029061 500 ng
EUR 329

NUAK2 Protein Vector (Human) (pPB-N-His)

PV029062 500 ng
EUR 329

NUAK2 Protein Vector (Human) (pPM-C-HA)

PV029063 500 ng
EUR 329

NUAK2 Protein Vector (Human) (pPM-C-His)

PV029064 500 ng
EUR 329

NUAK2 Protein Vector (Mouse) (pPB-C-His)

PV207086 500 ng
EUR 603

NUAK2 Protein Vector (Mouse) (pPB-N-His)

PV207087 500 ng
EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-HA)

PV207088 500 ng
EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-His)

PV207089 500 ng
EUR 603

NUAK2 Protein Vector (Mouse) (pPB-C-His)

PV207090 500 ng
EUR 603

NUAK2 Protein Vector (Mouse) (pPB-N-His)

PV207091 500 ng
EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-HA)

PV207092 500 ng
EUR 603

NUAK2 Protein Vector (Mouse) (pPM-C-His)

PV207093 500 ng
EUR 603

NUAK2 Protein Vector (Rat) (pPB-C-His)

PV286310 500 ng
EUR 603

NUAK2 Protein Vector (Rat) (pPB-N-His)

PV286311 500 ng
EUR 603

NUAK2 Protein Vector (Rat) (pPM-C-HA)

PV286312 500 ng
EUR 603

NUAK2 Protein Vector (Rat) (pPM-C-His)

PV286313 500 ng
EUR 603

Nuak2 3'UTR GFP Stable Cell Line

TU164389 1.0 ml Ask for price

NUAK2 3'UTR Luciferase Stable Cell Line

TU016047 1.0 ml
EUR 1394

Nuak2 3'UTR Luciferase Stable Cell Line

TU114389 1.0 ml Ask for price

NUAK2 3'UTR GFP Stable Cell Line

TU066047 1.0 ml
EUR 1394

Nuak2 3'UTR GFP Stable Cell Line

TU264254 1.0 ml Ask for price

Nuak2 3'UTR Luciferase Stable Cell Line

TU214254 1.0 ml Ask for price

Human NUAK Family Kinase 2 (NUAK2) ELISA Kit

abx381903-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NUAK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV663709 1.0 ug DNA
EUR 682

NUAK2 Rabbit Polyclonal Antibody