PAX7 Rabbit Polyclonal Antibody

PAX7 Rabbit Polyclonal Antibody

PAX7 Polyclonal Antibody

ABP59839-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAX7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAX7 from Human, Mouse. This PAX7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAX7 protein

PAX7 Polyclonal Antibody

ABP59839-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAX7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAX7 from Human, Mouse. This PAX7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAX7 protein

PAX7 Polyclonal Antibody

ABP59839-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAX7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAX7 from Human, Mouse. This PAX7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAX7 protein

PAX7 Rabbit pAb

A12740-100ul 100 ul
EUR 308

PAX7 Rabbit pAb

A12740-200ul 200 ul
EUR 459

PAX7 Rabbit pAb

A12740-20ul 20 ul
EUR 183

PAX7 Rabbit pAb

A12740-50ul 50 ul
EUR 223

PAX7 Rabbit mAb

A4134-100ul 100 ul
EUR 410

PAX7 Rabbit mAb

A4134-200ul 200 ul
EUR 571

PAX7 Rabbit mAb

A4134-20ul 20 ul
EUR 221

PAX7 Rabbit mAb

A4134-50ul 50 ul
EUR 287

PAX7 Rabbit pAb

A7335-100ul 100 ul
EUR 308

PAX7 Rabbit pAb

A7335-200ul 200 ul
EUR 459

PAX7 Rabbit pAb

A7335-20ul 20 ul
EUR 183

PAX7 Rabbit pAb

A7335-50ul 50 ul
EUR 223

PAX7 (PAX7/1187) Antibody

BNC551187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF555 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC551187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF555 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC610497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF660R conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC610497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF660R conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC611187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF660R conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC611187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF660R conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC680497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF568 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC680497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF568 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC400497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF640R conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC400497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF640R conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC401187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF640R conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC401187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF640R conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC430497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF543 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC430497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF543 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC431187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF543 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC431187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF543 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC470497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF647 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC470497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF647 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC471187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF647 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC471187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF647 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC550497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF555 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC550497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF555 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC040497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF405S conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC040497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF405S conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC050497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF405M conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC050497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF405M conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC051187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF405M conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC051187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF405M conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC041187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF405S conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC041187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF405S conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNUB1187-100 100uL
EUR 209
Description: Primary antibody against PAX7 (PAX7/1187), Concentration: 0.2mg/mL

PAX7 (PAX7/1187) Antibody

BNUB1187-500 500uL
EUR 458
Description: Primary antibody against PAX7 (PAX7/1187), Concentration: 0.2mg/mL

PAX7(PAX7/497) Antibody

BNUM0497-50 50uL
EUR 395
Description: Primary antibody against PAX7(PAX7/497), 1mg/mL

PAX7 (PAX7/1187) Antibody

BNUM1187-50 50uL
EUR 395
Description: Primary antibody against PAX7 (PAX7/1187), 1mg/mL

PAX7 (PAX7/1187) Antibody

BNC681187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF568 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC681187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF568 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC700497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF770 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC700497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF770 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC701187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF770 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC701187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF770 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC881187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF488A conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC881187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF488A conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC940497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF594 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC940497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF594 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC941187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF594 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC941187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF594 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCB1187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), Biotin conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCB1187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), Biotin conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCH0497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCH0497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCH1187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCH1187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC800497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF680 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC800497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF680 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC801187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF680 conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC801187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF680 conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC810497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF680R conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC810497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF680R conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCP0497-250 250uL
EUR 383
Description: Primary antibody against PAX7(PAX7/497), PerCP conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCP1187-250 250uL
EUR 383
Description: Primary antibody against PAX7 (PAX7/1187), PerCP conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCR0497-250 250uL
EUR 383
Description: Primary antibody against PAX7(PAX7/497), RPE conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCR1187-250 250uL
EUR 383
Description: Primary antibody against PAX7 (PAX7/1187), RPE conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCA0497-250 250uL
EUR 383
Description: Primary antibody against PAX7(PAX7/497), APC conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCA1187-250 250uL
EUR 383
Description: Primary antibody against PAX7 (PAX7/1187), APC conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCAP0497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCAP0497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCAP1187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNCAP1187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCB0497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), Biotin conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNCB0497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), Biotin conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC880497-100 100uL
EUR 199
Description: Primary antibody against PAX7(PAX7/497), CF488A conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNC880497-500 500uL
EUR 544
Description: Primary antibody against PAX7(PAX7/497), CF488A conjugate, Concentration: 0.1mg/mL

PAX7(PAX7/497) Antibody

BNUB0497-100 100uL
EUR 209
Description: Primary antibody against PAX7(PAX7/497), Concentration: 0.2mg/mL

PAX7(PAX7/497) Antibody

BNUB0497-500 500uL
EUR 458
Description: Primary antibody against PAX7(PAX7/497), Concentration: 0.2mg/mL

PAX7 (PAX7/1187) Antibody

BNC811187-100 100uL
EUR 199
Description: Primary antibody against PAX7 (PAX7/1187), CF680R conjugate, Concentration: 0.1mg/mL

PAX7 (PAX7/1187) Antibody

BNC811187-500 500uL
EUR 544
Description: Primary antibody against PAX7 (PAX7/1187), CF680R conjugate, Concentration: 0.1mg/mL

Anti-PAX7 Rabbit Monoclonal Antibody

M00845-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX7 Antibody. Validated in WB and tested in Human, Mouse, Rat.

PAX7 Antibody

AF7584 200ul
EUR 376
Description: PAX7 Antibody detects endogenous levels of PAX7.

PAX7 Antibody

ABD7915 100 ug
EUR 438

PAX7 Antibody

35869-100ul 100ul
EUR 252

PAX7 Antibody

49173-100ul 100ul
EUR 333

PAX7 Antibody

49173-50ul 50ul
EUR 239

PAX7 antibody

10R-1583 100 ug
EUR 512
Description: Mouse monoclonal PAX7 antibody

PAX7 Antibody

DF7915 200ul
EUR 304
Description: PAX7 Antibody detects endogenous levels of total PAX7.

PAX7 Antibody

1-CSB-PA891015
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAX7. Recognizes PAX7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

PAX7 Antibody

1-CSB-PA017493ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAX7. Recognizes PAX7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

Polyclonal PAX7 antibody - N-terminal region

APR00609G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAX7 - N-terminal region. This antibody is tested and proven to work in the following applications:

PAX7 (Phospho-Ser203) Polyclonal Conjugated Antibody

C12949 100ul
EUR 397

PAX7 Conjugated Antibody

C49173 100ul
EUR 397

PAX7 Conjugated Antibody

C35869 100ul
EUR 397

anti- PAX7 antibody

FNab06173 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: paired box 7
  • Uniprot ID: P23759
  • Gene ID: 5081
  • Research Area: Neuroscience, Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against PAX7

Anti-PAX7 antibody

PAab06173 100 ug
EUR 412

Anti-PAX7 antibody

STJ29474 100 µl
EUR 277
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The specific function of the paired box 7 gene is unknown but speculated to involve tumor suppression since fusion of this gene with a forkhead domain family member has been associated with alveolar rhabdomyosarcoma. Three transcript variants encoding different isoforms have been found for this gene.

Anti-PAX7 antibody

STJ114613 100 µl
EUR 277
Description: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The specific function of the paired box 7 gene is unknown but speculated to involve tumor suppression since fusion of this gene with a forkhead domain family member has been associated with alveolar rhabdomyosarcoma. Three transcript variants encoding different isoforms have been found for this gene.

Anti-PAX7 antibody

STJ192063 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAX7

Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody, Clone: PAX7/497

AMM01161G 7 ml
EUR 484
Description: A Monoclonal antibody against Human PAX7 (Rhabdomyosarcoma Marker). The antibodies are raised in Mouse and are from clone PAX7/497. This antibody is applicable in WB and IHC-F, IF, FC

Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody, Clone: PAX7/1187

AMM01162G 7 ml
EUR 484
Description: A Monoclonal antibody against Human PAX7 (Rhabdomyosarcoma Marker). The antibodies are raised in Mouse and are from clone PAX7/1187. This antibody is applicable in IHC

Anti-PAX7 Antibody Clone PAX7/497, Unconjugated-20ug

5081-MSM1-P0 20ug
EUR 233

Anti-PAX7 Antibody Clone PAX7/497, Unconjugated-100ug

5081-MSM1-P1 100ug
EUR 428

Anti-PAX7 Antibody Clone PAX7/1187, Unconjugated-100ug

5081-MSM2-P1 100ug
EUR 428

PAX7 siRNA

20-abx927811
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAX7 siRNA

20-abx927812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Anti-PAX7 monoclonal antibody, clone TE194-15

CABT-L797 100 ul
EUR 777

Phospho-PAX7(Ser203) Antibody

AF7084 200ul
EUR 376
Description: Phospho-PAX7(Ser203) Antibody detects endogenous levels of PAX7 only when phosphorylated at Ser203.

PAX7 recombinant monoclonal antibody

A5679 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human PAX7 for WB ,ELISA

PAX7 (Phospho-Ser203) Antibody

12949-100ul 100ul
EUR 252

PAX7 (Phospho-Ser203) Antibody

12949-50ul 50ul
EUR 187

PAX7 Blocking Peptide

AF7584-BP 1mg
EUR 195

PAX7 cloning plasmid

CSB-CL017493HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: ATGGCGGCCCTTCCCGGCACGGTACCGAGAATGATGCGGCCGGCTCCGGGGCAGAACTACCCCCGCACGGGATTCCCTTTGGAAGTGTCCACCCCGCTTGGCCAAGGCCGGGTCAATCAGCTGGGAGGGGTCTTCATCAATGGGCGACCCCTGCCTAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX7 gene.

PAX7 Blocking Peptide

DF7915-BP 1mg
EUR 195

Anti-PAX7 (3H1)

YF-MA14596 100 ug
EUR 363
Description: Mouse monoclonal to PAX7

Anti-PAX7 (1G11)

YF-MA14597 100 ug
EUR 363
Description: Mouse monoclonal to PAX7

Anti-PAX7 (4F8)

YF-MA14598 100 ug
EUR 363
Description: Mouse monoclonal to PAX7

Anti-PAX7 (2B9)

YF-MA14599 100 ug
EUR 363
Description: Mouse monoclonal to PAX7

Anti-PAX7 (3F10)

YF-MA14600 100 ug
EUR 363
Description: Mouse monoclonal to PAX7

Anti-PAX7 (4F5)

YF-MA14601 100 ug
EUR 363
Description: Mouse monoclonal to PAX7

Anti-PAX7 (3F10)

YF-MA20382 200 ul
EUR 363
Description: Mouse monoclonal to PAX7

Anti-Pax7 (3C9)

YF-MA10660 100 ug
EUR 363
Description: Mouse monoclonal to Pax7

Anti-Pax7 (1E12)

YF-MA10661 100 ug
EUR 363
Description: Mouse monoclonal to Pax7

Paired Box 7 (PAX7) Antibody

abx340001-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Paired Box 7 (PAX7) Antibody

abx236174-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody - Without BSA and Azide, Clone: PAX7/497

AMM00353G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PAX7 (Rhabdomyosarcoma Marker) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone PAX7/497. This antibody is applicable in WB and IHC-F, IF, FC

Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody - With BSA and Azide, Clone: PAX7/1187

AMM01163G 0.05mg
EUR 396
Description: A Monoclonal antibody against Human PAX7 (Rhabdomyosarcoma Marker) - With BSA and Azide. The antibodies are raised in Mouse and are from clone PAX7/1187. This antibody is applicable in IHC

Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody - Without BSA and Azide, Clone: PAX7/1187

AMM01164G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PAX7 (Rhabdomyosarcoma Marker) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone PAX7/1187. This antibody is applicable in IHC

Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody - With BSA and Azide, Clone: PAX7/497

APR14731G 0.05mg
EUR 396
Description: A Monoclonal antibody against Human PAX7 (Rhabdomyosarcoma Marker) - With BSA and Azide. The antibodies are raised in Mouse and are from clone PAX7/497. This antibody is applicable in WB and IHC, FC, IP, E

Anti-PAX7 (Rhabdomyosarcoma Marker) Monoclonal Antibody

M00845 100ug/vial
EUR 397
Description: Mouse Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody. Validated in IF and tested in Chicken, Human, Mouse, Rat, Zebrafish.

PAX7 ELISA KIT|Human

EF001580 96 Tests
EUR 689

Human PAX7 shRNA Plasmid

20-abx953379
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PAX7 shRNA Plasmid

20-abx971933
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PAX7 Recombinant Protein (Human)

RP042049 100 ug Ask for price

PAX7 Recombinant Protein (Rat)

RP219392 100 ug Ask for price

PAX7 Recombinant Protein (Mouse)

RP160295 100 ug Ask for price

Monoclonal PAX7 (Rhabdomyosarcoma Marker) Antibody, Clone: SPM613

AMM01165G 7 ml
EUR 484
Description: A Monoclonal antibody against Human PAX7 (Rhabdomyosarcoma Marker). The antibodies are raised in Mouse and are from clone SPM613. This antibody is applicable in IHC

Monoclonal PAX7 Antibody (clone 1E12), Clone: 1E12

AMM01923G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human PAX7 (clone 1E12). The antibodies are raised in Mouse and are from clone 1E12. This antibody is applicable in WB and IHC-P, E

Monoclonal PAX7 Antibody (monoclonal) (M07), Clone: 1G11

AMM03887G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PAX7 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 1G11. This antibody is applicable in WB and IF, E

Paired Box Protein Pax-7 (PAX7) Antibody

20-abx007128
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Box Protein Pax-7 (PAX7) Antibody

abx025740-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Paired Box Protein Pax-7 (PAX7) Antibody

abx025740-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Paired Box Protein Pax-7 (PAX7) Antibody

abx028232-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Paired Box Protein Pax-7 (PAX7) Antibody

abx028232-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Paired Box Protein Pax-7 (PAX7) Antibody

20-abx321447
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Box Protein Pax-7 (PAX7) Antibody

20-abx339741
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Box Protein Pax-7 (PAX7) Antibody

abx236173-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-PAX7 Antibody Clone SPM613, Unconjugated-100ug

5081-MSM2X-P1 100ug
EUR 428

Phospho-PAX7(Ser203) Blocking Peptide

AF7084-BP 1mg
EUR 195

Pax7 ORF Vector (Rat) (pORF)

ORF073132 1.0 ug DNA
EUR 506

PAX7 ORF Vector (Human) (pORF)

ORF014017 1.0 ug DNA
EUR 95

PAX7 Rabbit Polyclonal Antibody