PDCD5 Rabbit Polyclonal Antibody
PDCD5 Polyclonal Antibody |
ES10731-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PDCD5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PDCD5 Polyclonal Antibody |
ABP59856-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PDCD5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PDCD5 from Human, Mouse. This PDCD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDCD5 protein |
PDCD5 Polyclonal Antibody |
ABP59856-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PDCD5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PDCD5 from Human, Mouse. This PDCD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDCD5 protein |
PDCD5 Polyclonal Antibody |
ABP59856-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PDCD5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PDCD5 from Human, Mouse. This PDCD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDCD5 protein |
PDCD5 Polyclonal Antibody |
30883-100ul |
SAB |
100ul |
EUR 252 |
PDCD5 Polyclonal Antibody |
30883-50ul |
SAB |
50ul |
EUR 187 |
PDCD5 Rabbit pAb |
A7298-100ul |
Abclonal |
100 ul |
EUR 308 |
PDCD5 Rabbit pAb |
A7298-200ul |
Abclonal |
200 ul |
EUR 459 |
PDCD5 Rabbit pAb |
A7298-20ul |
Abclonal |
20 ul |
EUR 183 |
PDCD5 Rabbit pAb |
A7298-50ul |
Abclonal |
50 ul |
EUR 223 |
PDCD5 Polyclonal Conjugated Antibody |
C30883 |
SAB |
100ul |
EUR 397 |
Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit |
DLR-PDCD5-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Programmed Cell Death Protein 5 (PDCD5) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit |
DLR-PDCD5-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Programmed Cell Death Protein 5 (PDCD5) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit |
RD-PDCD5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit |
RD-PDCD5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit |
RDR-PDCD5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit |
RDR-PDCD5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
PDCD5 Antibody |
AF7602 |
Affbiotech |
200ul |
EUR 376 |
Description: PDCD5 Antibody detects endogenous levels of PDCD5. |
PDCD5 Antibody |
24834-100ul |
SAB |
100ul |
EUR 390 |
PDCD5 Antibody |
24838-100ul |
SAB |
100ul |
EUR 390 |
PDCD5 antibody |
70R-19173 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PDCD5 antibody |
PDCD5 Antibody |
DF2562 |
Affbiotech |
200ul |
EUR 304 |
Description: PDCD5 antibody detects endogenous levels of total PDCD5. |
PDCD5 Antibody |
1-CSB-PA017671ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against PDCD5. Recognizes PDCD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PDCD5 Antibody |
1-CSB-PA017671GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PDCD5. Recognizes PDCD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal PDCD5 Antibody (C-Terminus) |
APR02613G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDCD5 (C-Terminus). This antibody is tested and proven to work in the following applications: |
PDCD5 (Phospho-Ser119) Polyclonal Conjugated Antibody |
C12865 |
SAB |
100ul |
EUR 397 |
PDCD5 (Phospho-S119) Polyclonal Conjugated Antibody |
C12967 |
SAB |
100ul |
EUR 397 |
anti- PDCD5 antibody |
FNab06241 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: programmed cell death 5
- Uniprot ID: O14737
- Gene ID: 9141
- Research Area: Metabolism
|
Description: Antibody raised against PDCD5 |
Human PDCD5 Antibody |
32175-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-PDCD5 antibody |
STJ29437 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is upregulated during apoptosis where it translocates rapidly from the cytoplasm to the nucleus. The encoded protein may be an important regulator of K(lysine) acetyltransferase 5 (a protein involved in transcription, DNA damage response and cell cycle control) by inhibiting its proteasome-dependent degradation. Pseudogenes have been identified on chromosomes 5 and 12 |
Anti-PDCD5 antibody |
STJ191889 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PDCD5 |
PDCD5 siRNA |
20-abx928040 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDCD5 siRNA |
20-abx928041 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDCD5 protein |
30R-1167 |
Fitzgerald |
100 ug |
EUR 397 |
Description: Purified recombinant Human PDCD5 protein |
Phospho-PDCD5 (Ser119) Antibody |
AF7102 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-PDCD5 (S119) Antibody detects endogenous levels of PDCD5 only when phosphorylated at S119. |
PDCD5 (Phospho-Ser119) Antibody |
12865-100ul |
SAB |
100ul |
EUR 252 |
PDCD5 (Phospho-Ser119) Antibody |
12865-50ul |
SAB |
50ul |
EUR 187 |
PDCD5 (Phospho-S119) Antibody |
12967-100ul |
SAB |
100ul |
EUR 252 |
PDCD5 (Phospho-S119) Antibody |
12967-50ul |
SAB |
50ul |
EUR 187 |
PDCD5 Blocking Peptide |
AF7602-BP |
Affbiotech |
1mg |
EUR 195 |
PDCD5 cloning plasmid |
CSB-CL017671HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 378
- Sequence: atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaactt
- Show more
|
Description: A cloning plasmid for the PDCD5 gene. |
Human PDCD5 Protein |
abx060207-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-10 working days.
|
PDCD5 Blocking Peptide |
DF2562-BP |
Affbiotech |
1mg |
EUR 195 |
Human PDCD5 Antibody (Biotin Conjugate) |
32175-05121 |
AssayPro |
150 ug |
EUR 369 |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human) |
4-PAL105Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5) |
Programmed Cell Death 5 (PDCD5) Antibody |
20-abx114698 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human PDCD5 AssayLite Antibody (FITC Conjugate) |
32175-05141 |
AssayPro |
150 ug |
EUR 428 |
Human PDCD5 AssayLite Antibody (RPE Conjugate) |
32175-05151 |
AssayPro |
150 ug |
EUR 428 |
Human PDCD5 AssayLite Antibody (APC Conjugate) |
32175-05161 |
AssayPro |
150 ug |
EUR 428 |
Human PDCD5 AssayLite Antibody (PerCP Conjugate) |
32175-05171 |
AssayPro |
150 ug |
EUR 471 |
Mouse PDCD5 shRNA Plasmid |
20-abx974702 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PDCD5 shRNA Plasmid |
20-abx956047 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PDCD5 Recombinant Protein (Human) |
RP022837 |
ABM |
100 ug |
Ask for price |
PDCD5 Recombinant Protein (Rat) |
RP219728 |
ABM |
100 ug |
Ask for price |
PDCD5 Recombinant Protein (Mouse) |
RP160835 |
ABM |
100 ug |
Ask for price |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), APC |
4-PAL105Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with APC. |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), Biotinylated |
4-PAL105Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with Biotin. |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), Cy3 |
4-PAL105Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with Cy3. |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), FITC |
4-PAL105Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with FITC. |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), HRP |
4-PAL105Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with HRP. |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), PE |
4-PAL105Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with PE. |
Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), APC-Cy7 |
4-PAL105Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with APC-Cy7. |
Programmed Cell Death Protein 5 (PDCD5) Antibody |
20-abx128446 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Programmed Cell Death Protein 5 (PDCD5) Antibody |
20-abx142130 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Programmed Cell Death Protein 5 (PDCD5) Antibody |
abx037840-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Programmed Cell Death Protein 5 (PDCD5) Antibody |
20-abx005505 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Programmed Cell Death Protein 5 (PDCD5) Antibody |
20-abx174172 |
Abbexa |
|
|
|
Programmed Cell Death Protein 5 (PDCD5) Antibody |
20-abx320827 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Programmed Cell Death Protein 5 (PDCD5) Antibody |
abx236241-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Phospho-PDCD5 (Ser119) Blocking Peptide |
AF7102-BP |
Affbiotech |
1mg |
EUR 195 |
PDCD5 ORF Vector (Human) (pORF) |
ORF007613 |
ABM |
1.0 ug DNA |
EUR 95 |
Pdcd5 ORF Vector (Rat) (pORF) |
ORF073244 |
ABM |
1.0 ug DNA |
EUR 506 |
Pdcd5 ORF Vector (Mouse) (pORF) |
ORF053613 |
ABM |
1.0 ug DNA |
EUR 506 |
PDCD5 ELISA Kit (Human) (OKCD00601) |
OKCD00601 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: May function in the process of apoptosis. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL |
PDCD5 sgRNA CRISPR Lentivector set (Human) |
K1616201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Human PDCD5/TFAR19 (N-6His) |
CG07-10ug |
Novoprotein |
10ug |
EUR 146 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human PDCD5/TFAR19 (N-6His) |
CG07-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human PDCD5/TFAR19 (N-6His) |
CG07-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human PDCD5/TFAR19 (N-6His) |
CG07-50ug |
Novoprotein |
50ug |
EUR 339 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Pdcd5 sgRNA CRISPR Lentivector set (Mouse) |
K3990501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pdcd5 sgRNA CRISPR Lentivector set (Rat) |
K6584901 |
ABM |
3 x 1.0 ug |
EUR 339 |
PDCD5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1616202 |
ABM |
1.0 ug DNA |
EUR 154 |
PDCD5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1616203 |
ABM |
1.0 ug DNA |
EUR 154 |
PDCD5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1616204 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Programmed cell death protein 5 (PDCD5) |
1-CSB-EP017671HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 41.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Programmed cell death protein 5(PDCD5) expressed in E.coli |
Pdcd5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3990502 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdcd5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3990503 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdcd5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3990504 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdcd5 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6584902 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdcd5 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6584903 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdcd5 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6584904 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Programmed Cell Death Protein 5 (PDCD5) |
4-RPL105Hu01 |
Cloud-Clone |
-
EUR 483.49
-
EUR 232.00
-
EUR 1538.08
-
EUR 579.36
-
EUR 1058.72
-
EUR 386.00
-
EUR 3695.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O14737
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Programmed Cell Death Protein 5 expressed in: E.coli |
PDCD5 Protein Vector (Human) (pPB-C-His) |
PV030449 |
ABM |
500 ng |
EUR 329 |
PDCD5 Protein Vector (Human) (pPB-N-His) |
PV030450 |
ABM |
500 ng |
EUR 329 |
PDCD5 Protein Vector (Human) (pPM-C-HA) |
PV030451 |
ABM |
500 ng |
EUR 329 |
PDCD5 Protein Vector (Human) (pPM-C-His) |
PV030452 |
ABM |
500 ng |
EUR 329 |
PDCD5 Protein Vector (Mouse) (pPB-C-His) |
PV214450 |
ABM |
500 ng |
EUR 603 |
PDCD5 Protein Vector (Mouse) (pPB-N-His) |
PV214451 |
ABM |
500 ng |
EUR 603 |
PDCD5 Protein Vector (Mouse) (pPM-C-HA) |
PV214452 |
ABM |
500 ng |
EUR 603 |
PDCD5 Protein Vector (Mouse) (pPM-C-His) |
PV214453 |
ABM |
500 ng |
EUR 603 |
PDCD5 Protein Vector (Rat) (pPB-C-His) |
PV292974 |
ABM |
500 ng |
EUR 603 |
PDCD5 Protein Vector (Rat) (pPB-N-His) |
PV292975 |
ABM |
500 ng |
EUR 603 |
PDCD5 Protein Vector (Rat) (pPM-C-HA) |
PV292976 |
ABM |
500 ng |
EUR 603 |
PDCD5 Protein Vector (Rat) (pPM-C-His) |
PV292977 |
ABM |
500 ng |
EUR 603 |
Pdcd5 3'UTR GFP Stable Cell Line |
TU166087 |
ABM |
1.0 ml |
Ask for price |
PDCD5 3'UTR Luciferase Stable Cell Line |
TU017614 |
ABM |
1.0 ml |
EUR 1394 |
Pdcd5 3'UTR Luciferase Stable Cell Line |
TU116087 |
ABM |
1.0 ml |
Ask for price |
PDCD5 3'UTR GFP Stable Cell Line |
TU067614 |
ABM |
1.0 ml |
EUR 1394 |
Pdcd5 3'UTR GFP Stable Cell Line |
TU265977 |
ABM |
1.0 ml |
Ask for price |
Pdcd5 3'UTR Luciferase Stable Cell Line |
TU215977 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PDCD5 Rabbit Polyclonal Antibody