PDCD5 Rabbit Polyclonal Antibody

PDCD5 Rabbit Polyclonal Antibody

PDCD5 Polyclonal Antibody

ES10731-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PDCD5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDCD5 Polyclonal Antibody

ABP59856-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PDCD5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PDCD5 from Human, Mouse. This PDCD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDCD5 protein

PDCD5 Polyclonal Antibody

ABP59856-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PDCD5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PDCD5 from Human, Mouse. This PDCD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDCD5 protein

PDCD5 Polyclonal Antibody

ABP59856-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PDCD5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PDCD5 from Human, Mouse. This PDCD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDCD5 protein

PDCD5 Polyclonal Antibody

30883-100ul 100ul
EUR 252

PDCD5 Polyclonal Antibody

30883-50ul 50ul
EUR 187

PDCD5 Rabbit pAb

A7298-100ul 100 ul
EUR 308

PDCD5 Rabbit pAb

A7298-200ul 200 ul
EUR 459

PDCD5 Rabbit pAb

A7298-20ul 20 ul
EUR 183

PDCD5 Rabbit pAb

A7298-50ul 50 ul
EUR 223

PDCD5 Polyclonal Conjugated Antibody

C30883 100ul
EUR 397

Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit

DLR-PDCD5-Hu-48T 48T
EUR 554
  • Should the Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Programmed Cell Death Protein 5 (PDCD5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit

DLR-PDCD5-Hu-96T 96T
EUR 725
  • Should the Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Programmed Cell Death Protein 5 (PDCD5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit

RD-PDCD5-Hu-48Tests 48 Tests
EUR 563

Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit

RD-PDCD5-Hu-96Tests 96 Tests
EUR 783

Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit

RDR-PDCD5-Hu-48Tests 48 Tests
EUR 589

Human Programmed Cell Death Protein 5 (PDCD5) ELISA Kit

RDR-PDCD5-Hu-96Tests 96 Tests
EUR 820

PDCD5 Antibody

AF7602 200ul
EUR 376
Description: PDCD5 Antibody detects endogenous levels of PDCD5.

PDCD5 Antibody

ABD2562 100 ug
EUR 438

PDCD5 Antibody

24834-100ul 100ul
EUR 390

PDCD5 Antibody

24838-100ul 100ul
EUR 390

PDCD5 antibody

70R-19173 50 ul
EUR 435
Description: Rabbit polyclonal PDCD5 antibody

PDCD5 Antibody

DF2562 200ul
EUR 304
Description: PDCD5 antibody detects endogenous levels of total PDCD5.

PDCD5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PDCD5. Recognizes PDCD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PDCD5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PDCD5. Recognizes PDCD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal PDCD5 Antibody (C-Terminus)

APR02613G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDCD5 (C-Terminus). This antibody is tested and proven to work in the following applications:

PDCD5 (Phospho-Ser119) Polyclonal Conjugated Antibody

C12865 100ul
EUR 397

PDCD5 (Phospho-S119) Polyclonal Conjugated Antibody

C12967 100ul
EUR 397

anti- PDCD5 antibody

FNab06241 100µg
EUR 505.25
  • Immunogen: programmed cell death 5
  • Uniprot ID: O14737
  • Gene ID: 9141
  • Research Area: Metabolism
Description: Antibody raised against PDCD5

Human PDCD5 Antibody

32175-05111 150 ug
EUR 261

Anti-PDCD5 antibody

PAab06241 100 ug
EUR 355

Anti-PDCD5 antibody

STJ29437 100 µl
EUR 277
Description: This gene encodes a protein that is upregulated during apoptosis where it translocates rapidly from the cytoplasm to the nucleus. The encoded protein may be an important regulator of K(lysine) acetyltransferase 5 (a protein involved in transcription, DNA damage response and cell cycle control) by inhibiting its proteasome-dependent degradation. Pseudogenes have been identified on chromosomes 5 and 12

Anti-PDCD5 antibody

STJ191889 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDCD5


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PDCD5 protein

30R-1167 100 ug
EUR 397
Description: Purified recombinant Human PDCD5 protein

Phospho-PDCD5 (Ser119) Antibody

AF7102 200ul
EUR 376
Description: Phospho-PDCD5 (S119) Antibody detects endogenous levels of PDCD5 only when phosphorylated at S119.

PDCD5 (Phospho-Ser119) Antibody

12865-100ul 100ul
EUR 252

PDCD5 (Phospho-Ser119) Antibody

12865-50ul 50ul
EUR 187

PDCD5 (Phospho-S119) Antibody

12967-100ul 100ul
EUR 252

PDCD5 (Phospho-S119) Antibody

12967-50ul 50ul
EUR 187

PDCD5 Blocking Peptide

AF7602-BP 1mg
EUR 195

PDCD5 cloning plasmid

CSB-CL017671HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaactt
  • Show more
Description: A cloning plasmid for the PDCD5 gene.

Human PDCD5 Protein

abx060207-100ug 100 ug
EUR 523
  • Shipped within 5-10 working days.

PDCD5 Blocking Peptide

DF2562-BP 1mg
EUR 195


PVT13657 2 ug
EUR 391

Human PDCD5 Antibody (Biotin Conjugate)

32175-05121 150 ug
EUR 369

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5)

Programmed Cell Death 5 (PDCD5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human PDCD5 AssayLite Antibody (FITC Conjugate)

32175-05141 150 ug
EUR 428

Human PDCD5 AssayLite Antibody (RPE Conjugate)

32175-05151 150 ug
EUR 428

Human PDCD5 AssayLite Antibody (APC Conjugate)

32175-05161 150 ug
EUR 428

Human PDCD5 AssayLite Antibody (PerCP Conjugate)

32175-05171 150 ug
EUR 471

Mouse PDCD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001629 96 Tests
EUR 689

Human PDCD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PDCD5 Recombinant Protein (Human)

RP022837 100 ug Ask for price

PDCD5 Recombinant Protein (Rat)

RP219728 100 ug Ask for price

PDCD5 Recombinant Protein (Mouse)

RP160835 100 ug Ask for price

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with APC.

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with Biotin.

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with Cy3.

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with FITC.

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with HRP.

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with PE.

Programmed Cell Death Protein 5 (PDCD5) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDCD5 (Ala2~Tyr125)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Programmed Cell Death Protein 5 (PDCD5). This antibody is labeled with APC-Cy7.

Programmed Cell Death Protein 5 (PDCD5) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Programmed Cell Death Protein 5 (PDCD5) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Programmed Cell Death Protein 5 (PDCD5) Antibody

abx037840-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Programmed Cell Death Protein 5 (PDCD5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Programmed Cell Death Protein 5 (PDCD5) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Programmed Cell Death Protein 5 (PDCD5) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Programmed Cell Death Protein 5 (PDCD5) Antibody

abx236241-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Phospho-PDCD5 (Ser119) Blocking Peptide

AF7102-BP 1mg
EUR 195

PDCD5 ORF Vector (Human) (pORF)

ORF007613 1.0 ug DNA
EUR 95

Pdcd5 ORF Vector (Rat) (pORF)

ORF073244 1.0 ug DNA
EUR 506

Pdcd5 ORF Vector (Mouse) (pORF)

ORF053613 1.0 ug DNA
EUR 506

PDCD5 ELISA Kit (Human) (OKCD00601)

OKCD00601 96 Wells
EUR 909
Description: Description of target: May function in the process of apoptosis. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL

PDCD5 sgRNA CRISPR Lentivector set (Human)

K1616201 3 x 1.0 ug
EUR 339

Recombinant Human PDCD5/TFAR19 (N-6His)

CG07-10ug 10ug
EUR 146
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human PDCD5/TFAR19 (N-6His)

CG07-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human PDCD5/TFAR19 (N-6His)

CG07-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human PDCD5/TFAR19 (N-6His)

CG07-50ug 50ug
EUR 339
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Pdcd5 sgRNA CRISPR Lentivector set (Mouse)

K3990501 3 x 1.0 ug
EUR 339

Pdcd5 sgRNA CRISPR Lentivector set (Rat)

K6584901 3 x 1.0 ug
EUR 339

PDCD5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1616202 1.0 ug DNA
EUR 154

PDCD5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1616203 1.0 ug DNA
EUR 154

PDCD5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1616204 1.0 ug DNA
EUR 154

Human Programmed cell death protein 5 (PDCD5)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Programmed cell death protein 5(PDCD5) expressed in E.coli

Pdcd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3990502 1.0 ug DNA
EUR 154

Pdcd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3990503 1.0 ug DNA
EUR 154

Pdcd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3990504 1.0 ug DNA
EUR 154

Pdcd5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6584902 1.0 ug DNA
EUR 154

Pdcd5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6584903 1.0 ug DNA
EUR 154

Pdcd5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6584904 1.0 ug DNA
EUR 154

Recombinant Programmed Cell Death Protein 5 (PDCD5)

  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O14737
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Programmed Cell Death Protein 5 expressed in: E.coli

PDCD5 Protein Vector (Human) (pPB-C-His)

PV030449 500 ng
EUR 329

PDCD5 Protein Vector (Human) (pPB-N-His)

PV030450 500 ng
EUR 329

PDCD5 Protein Vector (Human) (pPM-C-HA)

PV030451 500 ng
EUR 329

PDCD5 Protein Vector (Human) (pPM-C-His)

PV030452 500 ng
EUR 329

PDCD5 Protein Vector (Mouse) (pPB-C-His)

PV214450 500 ng
EUR 603

PDCD5 Protein Vector (Mouse) (pPB-N-His)

PV214451 500 ng
EUR 603

PDCD5 Protein Vector (Mouse) (pPM-C-HA)

PV214452 500 ng
EUR 603

PDCD5 Protein Vector (Mouse) (pPM-C-His)

PV214453 500 ng
EUR 603

PDCD5 Protein Vector (Rat) (pPB-C-His)

PV292974 500 ng
EUR 603

PDCD5 Protein Vector (Rat) (pPB-N-His)

PV292975 500 ng
EUR 603

PDCD5 Protein Vector (Rat) (pPM-C-HA)

PV292976 500 ng
EUR 603

PDCD5 Protein Vector (Rat) (pPM-C-His)

PV292977 500 ng
EUR 603

Pdcd5 3'UTR GFP Stable Cell Line

TU166087 1.0 ml Ask for price

PDCD5 3'UTR Luciferase Stable Cell Line

TU017614 1.0 ml
EUR 1394

Pdcd5 3'UTR Luciferase Stable Cell Line

TU116087 1.0 ml Ask for price

PDCD5 3'UTR GFP Stable Cell Line

TU067614 1.0 ml
EUR 1394

Pdcd5 3'UTR GFP Stable Cell Line

TU265977 1.0 ml Ask for price

Pdcd5 3'UTR Luciferase Stable Cell Line

TU215977 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PDCD5 Rabbit Polyclonal Antibody