PLCB1 Rabbit Polyclonal Antibody

PLCB1 Rabbit Polyclonal Antibody

PLCB1 Rabbit pAb

A1971-100ul 100 ul
EUR 308

PLCB1 Rabbit pAb

A1971-200ul 200 ul
EUR 459

PLCB1 Rabbit pAb

A1971-20ul 20 ul
EUR 183

PLCB1 Rabbit pAb

A1971-50ul 50 ul
EUR 223

PLCB1 Antibody

32528-100ul 100ul
EUR 252

PLCB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PLCB1 Antibody

DF6726 200ul
EUR 304
Description: PLCB1 Antibody detects endogenous levels of total PLCB1.

PLCB1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PLCB1 Antibody

CSB-PA018126KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PLCB1 antibody

70R-5669 50 ug
EUR 467
Description: Rabbit polyclonal PLCB1 antibody

PLCB1 Antibody

ABD6726 100 ug
EUR 438

PLCB1 antibody

PAab10119 100 ug
EUR 386

Polyclonal PLCB1 Antibody (C-term)

AMR09343G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLCB1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Plcb1 Antibody - C-terminal region

AMM07235G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Plcb1 - C-terminal region. This antibody is tested and proven to work in the following applications:

PLCB1 Conjugated Antibody

C32528 100ul
EUR 397

anti- PLCB1 antibody

FNab10119 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: phospholipase C, beta 1
  • Uniprot ID: Q9NQ66
  • Gene ID: 23236
  • Research Area: Signal Transduction
Description: Antibody raised against PLCB1

Anti-PLCB1 antibody

STJ25023 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene.

Anti-PLCB1 antibody

STJ191891 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLCB1

Plcb1/ Rat Plcb1 ELISA Kit

ELI-05251r 96 Tests
EUR 657

Phospholipase C beta 1 (PLCB1) polyclonal antibody

ABP-PAB-01053 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PLCB1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLCB1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLCB1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PLCB1 Blocking Peptide

33R-2278 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLCB1 antibody, catalog no. 70R-5669

PLCB1 Blocking Peptide

DF6726-BP 1mg
EUR 195

PLCB1 cloning plasmid

CSB-CL865102HU1-10ug 10ug
EUR 1326
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3651
  • Sequence: atggccggggctcaacccggagtgcacgccttgcaactcaagcccgtgtgcgtgtccgacagcctcaagaagggcaccaaattcgtcaagtgggatgatgactcaactattgttactccaattattttgaggactgaccctcagggatttttcttttactggacagatcaaaaca
  • Show more
Description: A cloning plasmid for the PLCB1 gene.

PLCB1 cloning plasmid

CSB-CL865102HU2-10ug 10ug
EUR 1284
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3522
  • Sequence: atggccggggctcaacccggagtgcacgccttgcaactcaagcccgtgtgcgtgtccgacagcctcaagaagggcaccaaattcgtcaagtgggatgatgactcaactattgttactccaattattttgaggactgaccctcagggatttttcttttactggacagatcaaaaca
  • Show more
Description: A cloning plasmid for the PLCB1 gene.

Phospholipase C Beta 1 (PLCB1) Antibody

abx117174-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Phospholipase C Beta 1 (PLCB1) Antibody

abx034343-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phospholipase C Beta 1 (PLCB1) Antibody

abx034343-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phospholipase C Beta 1 (PLCB1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase C Beta 1 (PLCB1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.


ELA-E1605h 96 Tests
EUR 824

Mouse Plcb1 ELISA KIT

ELI-05248m 96 Tests
EUR 865


ELI-05249b 96 Tests
EUR 928


ELI-05250h 96 Tests
EUR 824

Mouse PLCB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PLCB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PLCB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospholipase C Beta 1 (PLCB1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase C Beta 1 (PLCB1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase C Beta 1 (PLCB1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Phospholipase C beta 1/PLCB1 Antibody

PB9346 100ug/vial
EUR 294

Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit

E04P0760-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit

E04P0760-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit

E04P0760-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit

abx363285-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Plcb1 ORF Vector (Rat) (pORF)

ORF073609 1.0 ug DNA
EUR 506

PLCB1 ORF Vector (Human) (pORF)

ORF014092 1.0 ug DNA
EUR 354

PLCB1 ORF Vector (Human) (pORF)

ORF007907 1.0 ug DNA
EUR 95

Plcb1 ORF Vector (Mouse) (pORF)

ORF054210 1.0 ug DNA
EUR 506

Plcb1 ORF Vector (Mouse) (pORF)

ORF054211 1.0 ug DNA
EUR 506

PLCB1 ELISA Kit (Mouse) (OKEH05393)

OKEH05393 96 Wells
EUR 662
Description: Description of target: The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL

PLCB1 ELISA Kit (Rat) (OKEH06133)

OKEH06133 96 Wells
EUR 662
Description: Description of target: The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL

PLCB1 ELISA Kit (Bovine) (OKEH08391)

OKEH08391 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08ng/mL

PLCB1 ELISA Kit (Human) (OKEH04261)

OKEH04261 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.045 ng/mL

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plcb1 sgRNA CRISPR Lentivector set (Rat)

K6748601 3 x 1.0 ug
EUR 339

Plcb1 sgRNA CRISPR Lentivector set (Mouse)

K3836201 3 x 1.0 ug
EUR 339

PLCB1 sgRNA CRISPR Lentivector set (Human)

K1662401 3 x 1.0 ug
EUR 339

PLCB1-IT1 ORF Vector (Human) (pORF)

ORF027934 1.0 ug DNA Ask for price

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1)

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with APC.

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with Biotin.

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with Cy3.

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with FITC.

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with HRP.

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with PE.

Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6748602 1.0 ug DNA
EUR 154

Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6748603 1.0 ug DNA
EUR 154

Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6748604 1.0 ug DNA
EUR 154

Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3836202 1.0 ug DNA
EUR 154

Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3836203 1.0 ug DNA
EUR 154

Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3836204 1.0 ug DNA
EUR 154

PLCB1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1662402 1.0 ug DNA
EUR 154

PLCB1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1662403 1.0 ug DNA
EUR 154

PLCB1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1662404 1.0 ug DNA
EUR 154

PLCB1 Protein Vector (Rat) (pPB-C-His)

PV294434 500 ng
EUR 1191

PLCB1 Protein Vector (Rat) (pPB-N-His)

PV294435 500 ng
EUR 1191

PLCB1 Protein Vector (Rat) (pPM-C-HA)

PV294436 500 ng
EUR 1191

PLCB1 Protein Vector (Rat) (pPM-C-His)

PV294437 500 ng
EUR 1191

PLCB1 Protein Vector (Human) (pPB-C-His)

PV031625 500 ng
EUR 329

PLCB1 Protein Vector (Human) (pPB-N-His)

PV031626 500 ng
EUR 329

PLCB1 Protein Vector (Human) (pPM-C-HA)

PV031627 500 ng
EUR 329

PLCB1 Protein Vector (Human) (pPM-C-His)

PV031628 500 ng
EUR 329

PLCB1 Protein Vector (Human) (pPB-C-His)

PV056365 500 ng
EUR 481

PLCB1 Protein Vector (Human) (pPB-N-His)

PV056366 500 ng
EUR 481

PLCB1 Protein Vector (Human) (pPM-C-HA)

PV056367 500 ng
EUR 481

PLCB1 Protein Vector (Human) (pPM-C-His)

PV056368 500 ng
EUR 481

PLCB1 Protein Vector (Mouse) (pPB-C-His)

PV216838 500 ng
EUR 1065

PLCB1 Protein Vector (Mouse) (pPB-N-His)

PV216839 500 ng
EUR 1065

PLCB1 Protein Vector (Mouse) (pPM-C-HA)

PV216840 500 ng
EUR 1065

PLCB1 Protein Vector (Mouse) (pPM-C-His)

PV216841 500 ng
EUR 1065

PLCB1 Protein Vector (Mouse) (pPB-C-His)

PV216842 500 ng
EUR 1065

PLCB1 Protein Vector (Mouse) (pPB-N-His)

PV216843 500 ng
EUR 1065

PLCB1 Protein Vector (Mouse) (pPM-C-HA)

PV216844 500 ng
EUR 1065

PLCB1 Protein Vector (Mouse) (pPM-C-His)

PV216845 500 ng
EUR 1065

Plcb1 3'UTR Luciferase Stable Cell Line

TU116496 1.0 ml Ask for price

Plcb1 3'UTR GFP Stable Cell Line

TU166496 1.0 ml Ask for price

PLCB1 3'UTR GFP Stable Cell Line

TU068205 1.0 ml
EUR 2333

PLCB1 3'UTR Luciferase Stable Cell Line

TU018205 1.0 ml
EUR 2333

Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with APC-Cy7.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

PLCB1 Rabbit Polyclonal Antibody