RAD1 Rabbit Polyclonal Antibody
 RAD1 Rabbit pAb |
|
A1047-100ul |
Abclonal |
100 ul |
EUR 308 |
RAD1 Rabbit pAb |
|
A1047-200ul |
Abclonal |
200 ul |
EUR 459 |
RAD1 Rabbit pAb |
|
A1047-20ul |
Abclonal |
20 ul |
EUR 183 |
RAD1 Rabbit pAb |
|
A1047-50ul |
Abclonal |
50 ul |
EUR 223 |
RAD1 Rabbit pAb |
|
A6841-100ul |
Abclonal |
100 ul |
EUR 308 |
RAD1 Rabbit pAb |
|
A6841-200ul |
Abclonal |
200 ul |
EUR 459 |
RAD1 Rabbit pAb |
|
A6841-20ul |
Abclonal |
20 ul |
EUR 183 |
RAD1 Rabbit pAb |
|
A6841-50ul |
Abclonal |
50 ul |
EUR 223 |
 RAD1 antibody |
|
70R-51320 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal RAD1 antibody |
RAD1 antibody |
|
70R-9526 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal RAD1 antibody |
RAD1 antibody |
|
38168-100ul |
SAB |
100ul |
EUR 252 |
 Rad1 antibody |
|
22948-100ul |
SAB |
100ul |
EUR 390 |
RAD1 antibody |
|
70R-19742 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RAD1 antibody |
RAD1 antibody |
|
70R-12488 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal RAD1 antibody |
 RAD1 Antibody |
|
DF6196 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RAD1 Antibody detects endogenous levels of total RAD1. |
RAD1 Antibody |
|
DF2364 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RAD1 antibody detects endogenous levels of total RAD1. |
RAD1 Antibody |
|
1-CSB-PA019252ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RAD1. Recognizes RAD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
RAD1 Antibody |
|
1-CSB-PA019252GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RAD1. Recognizes RAD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 Antibody) RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
20-abx123204 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
20-abx000974 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
abx146461-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
20-abx007833 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
abx028531-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
abx028531-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
20-abx321448 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAD1 Checkpoint DNA Exonuclease (RAD1) Antibody |
|
abx237073-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 ELISA kit) Rabbit Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E04C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E04C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E04C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 RAD1 Conjugated Antibody |
|
C38168 |
SAB |
100ul |
EUR 397 |
 anti- RAD1 antibody |
|
FNab07073 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: RAD1 homolog(S. pombe)
- Uniprot ID: O60671
- Gene ID: 5810
- Research Area: Epigenetics, Metabolism
|
|
Description: Antibody raised against RAD1 |
 Anti-RAD1 antibody |
|
STJ26167 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. |
Anti-RAD1 antibody |
|
STJ116309 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. |
Anti-RAD1 antibody |
|
STJ191721 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RAD1 |
 Protein) RAD1 Checkpoint DNA Exonuclease (RAD1) Protein |
|
20-abx262902 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 RAD1 siRNA |
|
20-abx930759 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAD1 siRNA |
|
20-abx930760 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-Rad1 |
|
YF-PA14224 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Rad1 |
anti-Rad1 |
|
YF-PA14225 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to Rad1 |
) Human Cell cycle checkpoint protein RAD1 (RAD1) |
|
1-CSB-EP019252HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 58.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Cell cycle checkpoint protein RAD1(RAD1) expressed in E.coli |
 ELISA Kit) Human RAD1 Checkpoint DNA Exonuclease (RAD1) ELISA Kit |
|
abx382654-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 RAD1 cloning plasmid |
|
CSB-CL019252HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 849
- Sequence: atgccccttctgacccaacagatccaagacgaggatgatcagtacagccttgtggccagccttgacaacgttaggaatctctccactatcttgaaagctattcatttccgagaacatgccacgtgtttcgcaactaaaaatggtatcaaagtaacagtggaaaatgcaaagtgtgt
- Show more
|
|
Description: A cloning plasmid for the RAD1 gene. |
 RAD1 Blocking Peptide |
|
20-abx064195 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAD1 Blocking Peptide |
|
33R-4182 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD1 antibody, catalog no. 70R-9526 |
RAD1 Blocking Peptide |
|
DF6196-BP |
Affbiotech |
1mg |
EUR 195 |
RAD1 Blocking Peptide |
|
DF2364-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-Rad1 (1G2) |
|
YF-MA15063 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Rad1 |
) Anti-Rad1 (1A12) |
|
YF-MA15064 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Rad1 |
) Anti-RAD1 (1G2) |
|
YF-MA20407 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to RAD1 |
Anti-Rad1 (1G2) |
|
YF-MA10758 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Rad1 |
 Antibody) Rad1 Homolog (S. Pombe) Antibody |
|
20-abx115011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 ELISA kit) Goat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E06C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E06C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E06C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E01C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E01C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E01C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E02C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E02C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E02C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E03C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E03C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E03C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Dog Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E08C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E08C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E08C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E09C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E09C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E09C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E07C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E07C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E07C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Mouse Cell cycle checkpoint protein RAD1, Rad1 ELISA KIT |
|
ELI-18200m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Cell cycle checkpoint protein RAD1, RAD1 ELISA KIT |
|
ELI-14922h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA kit) Guinea pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E05C2412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E05C2412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cell cycle checkpoint protein RAD1(RAD1) ELISA kit |
|
E05C2412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint protein RAD1(RAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human RAD1 shRNA Plasmid |
|
20-abx953928 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RAD1 protein (His tag) |
|
80R-1407 |
Fitzgerald |
50 ug |
EUR 397 |
|
Description: Purified recombinant Human RAD1 protein |
 Mouse RAD1 shRNA Plasmid |
|
20-abx972358 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 RAD1 Human Recombinant Protein |
|
PROTO60671 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: RAD1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (1-282 a.a.) and having a molecular mass of 33.9 kDa. The RAD1 is fused to 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
) RAD1 Recombinant Protein (Human) |
|
RP025618 |
ABM |
100 ug |
Ask for price |
) RAD1 Recombinant Protein (Rat) |
|
RP223454 |
ABM |
100 ug |
Ask for price |
) RAD1 Recombinant Protein (Mouse) |
|
RP166460 |
ABM |
100 ug |
Ask for price |
 (pORF)) RAD1 ORF Vector (Human) (pORF) |
|
ORF008540 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Rad1 ORF Vector (Rat) (pORF) |
|
ORF074486 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Rad1 ORF Vector (Mouse) (pORF) |
|
ORF055488 |
ABM |
1.0 ug DNA |
EUR 506 |
) RAD1 sgRNA CRISPR Lentivector set (Human) |
|
K1777901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rad1 sgRNA CRISPR Lentivector set (Rat) |
|
K6411301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rad1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4981501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) RAD1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1777902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RAD1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1777903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RAD1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1777904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rad1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6411302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rad1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6411303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rad1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6411304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rad1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4981502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rad1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4981503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rad1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4981504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) RAD1 Protein Vector (Human) (pPB-C-His) |
|
PV034157 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) RAD1 Protein Vector (Human) (pPB-N-His) |
|
PV034158 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) RAD1 Protein Vector (Human) (pPM-C-HA) |
|
PV034159 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) RAD1 Protein Vector (Human) (pPM-C-His) |
|
PV034160 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) RAD1 Protein Vector (Rat) (pPB-C-His) |
|
PV297942 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RAD1 Protein Vector (Rat) (pPB-N-His) |
|
PV297943 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RAD1 Protein Vector (Rat) (pPM-C-HA) |
|
PV297944 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RAD1 Protein Vector (Rat) (pPM-C-His) |
|
PV297945 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) RAD1 Protein Vector (Mouse) (pPB-C-His) |
|
PV221950 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RAD1 Protein Vector (Mouse) (pPB-N-His) |
|
PV221951 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RAD1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV221952 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RAD1 Protein Vector (Mouse) (pPM-C-His) |
|
PV221953 |
ABM |
500 ng |
EUR 603 |
 Rad1 3'UTR GFP Stable Cell Line |
|
TU167464 |
ABM |
1.0 ml |
Ask for price |
 RAD1 3'UTR Luciferase Stable Cell Line |
|
TU019429 |
ABM |
1.0 ml |
EUR 2333 |
 Rad1 3'UTR Luciferase Stable Cell Line |
|
TU117464 |
ABM |
1.0 ml |
Ask for price |
 RAD1 3'UTR GFP Stable Cell Line |
|
TU069429 |
ABM |
1.0 ml |
EUR 2333 |
Rad1 3'UTR GFP Stable Cell Line |
|
TU267244 |
ABM |
1.0 ml |
Ask for price |
Rad1 3'UTR Luciferase Stable Cell Line |
|
TU217244 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
RAD1 Rabbit Polyclonal Antibody
ELISA Kit)
