RASA1 Rabbit Polyclonal Antibody

RASA1 Rabbit Polyclonal Antibody

RASA1 Polyclonal Antibody

ABP60095-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RASA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RASA1 from Human, Rat. This RASA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RASA1 protein

RASA1 Polyclonal Antibody

ABP60095-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RASA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RASA1 from Human, Rat. This RASA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RASA1 protein

RASA1 Polyclonal Antibody

ABP60095-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RASA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RASA1 from Human, Rat. This RASA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RASA1 protein

RASA1 Polyclonal Antibody

A63286 100 µg
EUR 570.55
Description: reagents widely cited

RASA1 Rabbit pAb

A1634-100ul 100 ul
EUR 308

RASA1 Rabbit pAb

A1634-200ul 200 ul
EUR 459

RASA1 Rabbit pAb

A1634-20ul 20 ul
EUR 183

RASA1 Rabbit pAb

A1634-50ul 50 ul
EUR 223

Rasa1 antibody

70R-8527 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Rasa1 antibody

RASA1 Antibody

ABD2645 100 ug
EUR 438

RASA1 Antibody

ABD6519 100 ug
EUR 438

RASA1 antibody

38272-100ul 100ul
EUR 252

RASA1 Antibody

43529-100ul 100ul
EUR 252

RASA1 antibody

70R-19781 50 ul
EUR 435
Description: Rabbit polyclonal RASA1 antibody

RASA1 Antibody

DF6519 200ul
EUR 304
Description: RASA1 Antibody detects endogenous levels of total RASA1.

RASA1 Antibody

DF2645 200ul
EUR 304
Description: RASA1 antibody detects endogenous levels of total RASA1.

RASA1 Antibody

1-CSB-PA019346GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RASA1. Recognizes RASA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RASA1 Antibody

1-CSB-PA019346LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASA1. Recognizes RASA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

RASA1 Polyclonal Antibody, HRP Conjugated

A63287 100 µg
EUR 570.55
Description: Ask the seller for details

RASA1 Polyclonal Antibody, FITC Conjugated

A63288 100 µg
EUR 570.55
Description: The best epigenetics products

RASA1 Polyclonal Antibody, Biotin Conjugated

A63289 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal Rasa1 antibody - C-terminal region

AMM07534G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rasa1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Rasa1/ Rat Rasa1 ELISA Kit

ELI-19523r 96 Tests
EUR 886

RASA1 Conjugated Antibody

C38272 100ul
EUR 397

Anti-RASA1 Antibody

PB9796 100ug/vial
EUR 294

Anti-RASA1 antibody

STJ25303 100 µl
EUR 277
Description: The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues.

Anti-RASA1 antibody

STJ191957 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RASA1

RASA1 siRNA

20-abx930912
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RASA1 siRNA

20-abx930913
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pBlueScriptR-RASA1

PVT17389 2 ug
EUR 300

RASA1 Antibody, HRP conjugated

1-CSB-PA019346LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASA1. Recognizes RASA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RASA1 Antibody, FITC conjugated

1-CSB-PA019346LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASA1. Recognizes RASA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RASA1 Antibody, Biotin conjugated

1-CSB-PA019346LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASA1. Recognizes RASA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RASA1 cloning plasmid

CSB-CL019346HU-10ug 10ug
EUR 1158
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3144
  • Sequence: atgatggcggccgaggccggcagtgaggagggcggcccggtaacagccggagctggaggaggcggcgcggcagcgggctccagtgcctatcccgcagtgtgtcgggtgaagatacccgcggccctgcctgtggcagccgccccctatcctgggctggtggagaccggagtggctg
  • Show more
Description: A cloning plasmid for the RASA1 gene.

Rasa1 Blocking Peptide

33R-8652 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Rasa1 antibody, catalog no. 70R-8527

RASA1 Blocking Peptide

DF6519-BP 1mg
EUR 195

RASA1 Blocking Peptide

DF2645-BP 1mg
EUR 195

Anti-RASA1 (2C12)

YF-MA20215 200 ul
EUR 363
Description: Mouse monoclonal to RASA1

Rat RASA1 shRNA Plasmid

20-abx985216
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RASA1 ELISA KIT|Human

EF005933 96 Tests
EUR 689

Human RASA1 shRNA Plasmid

20-abx954007
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pMIR-Reporter-RASA1(3

PVTB00444-2a 2 ug
EUR 356

Ras GTPase Activating Protein 1 (RASA1) Polyclonal Antibody (Human, Mouse, Rat)

4-PAB616Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RASA1 (Pro403~Leu596)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Ras GTPase Activating Protein 1 (RASA1)

Monoclonal RASA1 Antibody (monoclonal) (M01), Clone: 2C12

AMM03992G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RASA1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2C12. This antibody is applicable in WB and IHC, E

Ras GTPase-Activating Protein 1 (RASA1) Antibody

20-abx115066
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras GTPase Activating Protein 1 (RASA1) Antibody

20-abx128801
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ras GTPase-Activating Protein 1 (RASA1) Antibody

20-abx001377
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras GTPase-Activating Protein 1 (RASA1) Antibody

20-abx318063
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RASA1 ORF Vector (Human) (pORF)

ORF008601 1.0 ug DNA
EUR 95

Rasa1 ORF Vector (Rat) (pORF)

ORF074550 1.0 ug DNA
EUR 506

Rasa1 ORF Vector (Mouse) (pORF)

ORF055623 1.0 ug DNA
EUR 506

Ras GTPase Activating Protein 1 (RASA1) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAB616Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RASA1 (Pro403~Leu596)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Ras GTPase Activating Protein 1 (RASA1). This antibody is labeled with APC.

Ras GTPase Activating Protein 1 (RASA1) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAB616Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RASA1 (Pro403~Leu596)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Ras GTPase Activating Protein 1 (RASA1). This antibody is labeled with Biotin.

Ras GTPase Activating Protein 1 (RASA1) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAB616Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RASA1 (Pro403~Leu596)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Ras GTPase Activating Protein 1 (RASA1). This antibody is labeled with Cy3.

Ras GTPase Activating Protein 1 (RASA1) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAB616Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RASA1 (Pro403~Leu596)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Ras GTPase Activating Protein 1 (RASA1). This antibody is labeled with FITC.

Ras GTPase Activating Protein 1 (RASA1) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAB616Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RASA1 (Pro403~Leu596)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Ras GTPase Activating Protein 1 (RASA1). This antibody is labeled with HRP.

RASA1 Rabbit Polyclonal Antibody