Da vinci european bio bank

REV1 Rabbit Polyclonal Antibody

REV1 Polyclonal Antibody
ABP60133-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human REV1 protein Applications tips:
Description: A polyclonal antibody for detection of REV1 from Human. This REV1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REV1 protein

REV1 Polyclonal Antibody
ABP60133-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human REV1 protein Applications tips:
Description: A polyclonal antibody for detection of REV1 from Human. This REV1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REV1 protein

REV1 Polyclonal Antibody
ABP60133-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human REV1 protein Applications tips:
Description: A polyclonal antibody for detection of REV1 from Human. This REV1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REV1 protein

REV1 Polyclonal Antibody
ES10754-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against REV1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

REV1 Polyclonal Antibody
ES10754-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against REV1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC
4-PAM132Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Asn472~Val652) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Biotinylated
4-PAM132Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Asn472~Val652) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Cy3
4-PAM132Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Asn472~Val652) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Polyclonal Antibody (Human), FITC
4-PAM132Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Asn472~Val652) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), HRP
4-PAM132Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Asn472~Val652) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Polyclonal Antibody (Human), PE
4-PAM132Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Asn472~Val652) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse)
4-PAM132Hu02	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1)

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC
4-PAM132Hu03-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Cys834~Gly976) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Biotinylated
4-PAM132Hu03-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Cys834~Gly976) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Cy3
4-PAM132Hu03-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Cys834~Gly976) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Polyclonal Antibody (Human), FITC
4-PAM132Hu03-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Cys834~Gly976) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), HRP
4-PAM132Hu03-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Cys834~Gly976) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Polyclonal Antibody (Human), PE
4-PAM132Hu03-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Cys834~Gly976) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 Rabbit pAb
A8493-100ul	Abclonal	100 ul	EUR 308

REV1 Rabbit pAb
A8493-200ul	Abclonal	200 ul	EUR 459

REV1 Rabbit pAb
A8493-20ul	Abclonal	20 ul	EUR 183

REV1 Rabbit pAb
A8493-50ul	Abclonal	50 ul	EUR 223

REV1 Homolog (REV1) Antibody
20-abx101026	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

REV1 Homolog (REV1) Antibody
20-abx101027	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

REV1 Homolog (REV1) Antibody
20-abx101028	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

REV1 Homolog (REV1) Antibody
20-abx132049	Abbexa	EUR 356.00 EUR 926.00 EUR 467.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC-Cy7
4-PAM132Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Asn472~Val652) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), APC
4-PAM132Hu02-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAM132Hu02-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAM132Hu02-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), FITC
4-PAM132Hu02-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), HRP
4-PAM132Hu02-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), PE
4-PAM132Hu02-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC-Cy7
4-PAM132Hu03-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Cys834~Gly976) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Homolog (REV1) Antibody (Biotin)
20-abx272504	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAM132Hu02-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REV1 (Ser301~Lys478) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Antibody
44849-100ul	SAB	100ul	EUR 252

REV1 Antibody
44849-50ul	SAB	50ul	EUR 187

REV1 Antibody
1-CSB-PA883372LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

REV1 Antibody
DF2581	Affbiotech	200ul	EUR 304
Description: REV1 antibody detects endogenous levels of total REV1.

REV1 Antibody
ABD2581	Lifescience Market	100 ug	EUR 438

DNA Repair Protein REV1 (REV1) Antibody
20-abx005855	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

DNA Repair Protein REV1 (REV1) Antibody
20-abx148077	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Recombinant REV1 Homolog (REV1)
4-RPM132Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UBZ9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.3kDa Isoelectric Point: Inquire
Description: Recombinant Human REV1 Homolog expressed in: E.coli

Recombinant REV1 Homolog (REV1)
4-RPM132Hu02	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UBZ9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.9kDa Isoelectric Point: Inquire
Description: Recombinant Human REV1 Homolog expressed in: E.coli

Recombinant REV1 Homolog (REV1)
4-RPM132Hu03	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UBZ9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.2kDa Isoelectric Point: Inquire
Description: Recombinant Human REV1 Homolog expressed in: E.coli

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat)
4-MAM132Hu21	Cloud-Clone	EUR 270.00 EUR 2879.00 EUR 709.00 EUR 343.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1)

Human REV1 Homolog (REV1) Protein
20-abx068903	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human REV1 Homolog (REV1) Protein
20-abx068904	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human REV1 Homolog (REV1) Protein
20-abx068905	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human REV1 Antibody
32076-05111	AssayPro	150 ug	EUR 261

REV1 Conjugated Antibody
C44849	SAB	100ul	EUR 397

Anti-REV1 antibody
STJ110791	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA.

Anti-REV1 antibody
STJ191912	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to REV1

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), APC
4-MAM132Hu21-APC	Cloud-Clone	EUR 380.00 EUR 3779.00 EUR 1038.00 EUR 490.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), Biotinylated
4-MAM132Hu21-Biotin	Cloud-Clone	EUR 337.00 EUR 2829.00 EUR 819.00 EUR 417.00 EUR 230.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), Cy3
4-MAM132Hu21-Cy3	Cloud-Clone	EUR 465.00 EUR 4997.00 EUR 1343.00 EUR 612.00 EUR 271.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), FITC
4-MAM132Hu21-FITC	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), HRP
4-MAM132Hu21-HRP	Cloud-Clone	EUR 346.00 EUR 3291.00 EUR 916.00 EUR 441.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), PE
4-MAM132Hu21-PE	Cloud-Clone	EUR 324.00 EUR 3043.00 EUR 850.00 EUR 412.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 siRNA
20-abx931293	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

REV1 siRNA
20-abx931294	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-REV1
YF-PA26188	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to REV1

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), APC-Cy7
4-MAM132Hu21-APC-Cy7	Cloud-Clone	EUR 641.00 EUR 7438.00 EUR 1957.00 EUR 860.00 EUR 349.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser301~Lys478 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Antibody, HRP conjugated
1-CSB-PA883372LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

REV1 Antibody, FITC conjugated
1-CSB-PA883372LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

REV1 Antibody, Biotin conjugated
1-CSB-PA883372LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

REV1 Blocking Peptide
DF2581-BP	Affbiotech	1mg	EUR 195

REV1 Polymerase (Recombinant)
20-abx073440	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

REV1 cloning plasmid
CSB-CL883372HU-10ug	Cusabio	10ug	EUR 1322
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3753 Sequence: atgaggcgaggtggatggaggaagcgagctgaaaatgatggctgggaaacatggggtgggtatatggctgccaaggtccagaaattggaggaacagtttcgatcagatgctgctatgcagaaggatgggacttcatctacaatttttagtggagttgccatctatgttaatggat Show more
Description: A cloning plasmid for the REV1 gene.

Human REV1 Antibody (Biotin Conjugate)
32076-05121	AssayPro	150 ug	EUR 369

Human REV1 (DNA repair protein REV1) ELISA Kit (CUSTOM)
ELI-52641h	Lifescience Market	96 Tests	EUR 824

Chicken REV1 (DNA repair protein REV1) ELISA Kit (CUSTOM)
ELI-35653c	Lifescience Market	96 Tests	EUR 928

Mouse REV1 (DNA repair protein REV1) ELISA Kit (CUSTOM)
ELI-41191m	Lifescience Market	96 Tests	EUR 865

REV1 protein (His tag)
80R-3801	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant REV1 protein (His tag)

Mouse REV1 shRNA Plasmid
20-abx974649	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human REV1 shRNA Plasmid
20-abx959774	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCD513B-1-Rev1 Plasmid
PVTB70014-4a	Lifescience Market	2 ug	EUR 356

Human REV1 AssayLite Antibody (FITC Conjugate)
32076-05141	AssayPro	150 ug	EUR 428

Human REV1 AssayLite Antibody (RPE Conjugate)
32076-05151	AssayPro	150 ug	EUR 428

Human REV1 AssayLite Antibody (APC Conjugate)
32076-05161	AssayPro	150 ug	EUR 428

Human REV1 AssayLite Antibody (PerCP Conjugate)
32076-05171	AssayPro	150 ug	EUR 471

Rev1 ORF Vector (Rat) (pORF)
ORF074711	ABM	1.0 ug DNA	EUR 506

REV1 ORF Vector (Human) (pORF)
ORF014272	ABM	1.0 ug DNA	EUR 354

Rev1 ORF Vector (Mouse) (pORF)
ORF055895	ABM	1.0 ug DNA	EUR 506

REV1 Polymerase Human Recombinant Protein
PROTQ9UBZ9	BosterBio	Regular: 20ug	EUR 317
Description: REV1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 227 amino acids (51-256) and having a molecular mass of 25.2kDa.;REV1 is fused to a 21 amino acid His-tag at N-terminus.

Rev1 sgRNA CRISPR Lentivector set (Rat)
K6298601	ABM	3 x 1.0 ug	EUR 339

REV1 sgRNA CRISPR Lentivector set (Human)
K1810001	ABM	3 x 1.0 ug	EUR 339

Rev1 sgRNA CRISPR Lentivector set (Mouse)
K3944401	ABM	3 x 1.0 ug	EUR 339

Recombinant human DNA repair protein REV1
P2230	FN Test	100ug	Ask for price
Uniprot ID: Q9UBZ9 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human DNA repair protein REV1

Rev1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6298602	ABM	1.0 ug DNA	EUR 154

Rev1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6298603	ABM	1.0 ug DNA	EUR 154

Rev1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6298604	ABM	1.0 ug DNA	EUR 154

REV1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1810002	ABM	1.0 ug DNA	EUR 154

REV1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1810003	ABM	1.0 ug DNA	EUR 154

REV1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1810004	ABM	1.0 ug DNA	EUR 154

Rev1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3944402	ABM	1.0 ug DNA	EUR 154

Rev1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3944403	ABM	1.0 ug DNA	EUR 154

Rev1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3944404	ABM	1.0 ug DNA	EUR 154

REV1 Protein Vector (Rat) (pPB-C-His)
PV298842	ABM	500 ng	EUR 1191

REV1 Protein Vector (Rat) (pPB-N-His)
PV298843	ABM	500 ng	EUR 1191

REV1 Protein Vector (Rat) (pPM-C-HA)
PV298844	ABM	500 ng	EUR 1191

REV1 Protein Vector (Rat) (pPM-C-His)
PV298845	ABM	500 ng	EUR 1191

REV1 Protein Vector (Human) (pPB-C-His)
PV057085	ABM	500 ng	EUR 481

REV1 Protein Vector (Human) (pPB-N-His)
PV057086	ABM	500 ng	EUR 481

REV1 Protein Vector (Human) (pPM-C-HA)
PV057087	ABM	500 ng	EUR 481

REV1 Protein Vector (Human) (pPM-C-His)
PV057088	ABM	500 ng	EUR 481

REV1 Protein Vector (Mouse) (pPB-C-His)
PV223578	ABM	500 ng	EUR 1065

REV1 Protein Vector (Mouse) (pPB-N-His)
PV223579	ABM	500 ng	EUR 1065

REV1 Protein Vector (Mouse) (pPM-C-HA)
PV223580	ABM	500 ng	EUR 1065

REV1 Protein Vector (Mouse) (pPM-C-His)
PV223581	ABM	500 ng	EUR 1065

Recombinant Human REV1 Protein, His, E.coli-1mg
QP13301-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human REV1 Protein, His, E.coli-20ug
QP13301-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human REV1 Protein, His, E.coli-5ug
QP13301-5ug	EnQuireBio	5ug	EUR 155

Rev1 3'UTR Luciferase Stable Cell Line
TU117741	ABM	1.0 ml	Ask for price

Rev1 3'UTR GFP Stable Cell Line
TU167741	ABM	1.0 ml	Ask for price

Rev1 3'UTR Luciferase Stable Cell Line
TU217490	ABM	1.0 ml	Ask for price

Rev1 3'UTR GFP Stable Cell Line
TU267490	ABM	1.0 ml	Ask for price

REV1 3'UTR GFP Stable Cell Line
TU069769	ABM	1.0 ml	EUR 2333

REV1 3'UTR Luciferase Stable Cell Line
TU019769	ABM	1.0 ml	EUR 2333

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

REV1 Rabbit Polyclonal Antibody