REV1 Rabbit Polyclonal Antibody

REV1 Rabbit Polyclonal Antibody

REV1 Polyclonal Antibody

ABP60133-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human REV1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of REV1 from Human. This REV1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REV1 protein

REV1 Polyclonal Antibody

ABP60133-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human REV1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of REV1 from Human. This REV1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REV1 protein

REV1 Polyclonal Antibody

ABP60133-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human REV1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of REV1 from Human. This REV1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human REV1 protein

REV1 Polyclonal Antibody

ES10754-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against REV1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

REV1 Polyclonal Antibody

ES10754-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against REV1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC

4-PAM132Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Asn472~Val652)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Biotinylated

4-PAM132Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Asn472~Val652)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Cy3

4-PAM132Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Asn472~Val652)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Polyclonal Antibody (Human), FITC

4-PAM132Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Asn472~Val652)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), HRP

4-PAM132Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Asn472~Val652)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Polyclonal Antibody (Human), PE

4-PAM132Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Asn472~Val652)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse)

4-PAM132Hu02
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1)

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC

4-PAM132Hu03-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Cys834~Gly976)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Biotinylated

4-PAM132Hu03-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Cys834~Gly976)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Polyclonal Antibody (Human), Cy3

4-PAM132Hu03-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Cys834~Gly976)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Polyclonal Antibody (Human), FITC

4-PAM132Hu03-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Cys834~Gly976)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Polyclonal Antibody (Human), HRP

4-PAM132Hu03-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Cys834~Gly976)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Polyclonal Antibody (Human), PE

4-PAM132Hu03-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Cys834~Gly976)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 Rabbit pAb

A8493-100ul 100 ul
EUR 308

REV1 Rabbit pAb

A8493-200ul 200 ul
EUR 459

REV1 Rabbit pAb

A8493-20ul 20 ul
EUR 183

REV1 Rabbit pAb

A8493-50ul 50 ul
EUR 223

REV1 Homolog (REV1) Antibody

20-abx101026
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

REV1 Homolog (REV1) Antibody

20-abx101027
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

REV1 Homolog (REV1) Antibody

20-abx101028
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

REV1 Homolog (REV1) Antibody

20-abx132049
  • EUR 356.00
  • EUR 926.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC-Cy7

4-PAM132Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Asn472~Val652)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), APC

4-PAM132Hu02-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAM132Hu02-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), Cy3

4-PAM132Hu02-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), FITC

4-PAM132Hu02-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), HRP

4-PAM132Hu02-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), PE

4-PAM132Hu02-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 Homolog (REV1) Polyclonal Antibody (Human), APC-Cy7

4-PAM132Hu03-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Cys834~Gly976)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Homolog (REV1) Antibody (Biotin)

20-abx272504
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

REV1 Homolog (REV1) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAM132Hu02-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REV1 (Ser301~Lys478)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Antibody

44849-100ul 100ul
EUR 252

REV1 Antibody

44849-50ul 50ul
EUR 187

REV1 Antibody

1-CSB-PA883372LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

REV1 Antibody

DF2581 200ul
EUR 304
Description: REV1 antibody detects endogenous levels of total REV1.

REV1 Antibody

ABD2581 100 ug
EUR 438

DNA Repair Protein REV1 (REV1) Antibody

20-abx005855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DNA Repair Protein REV1 (REV1) Antibody

20-abx148077
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant REV1 Homolog (REV1)

4-RPM132Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UBZ9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human REV1 Homolog expressed in: E.coli

Recombinant REV1 Homolog (REV1)

4-RPM132Hu02
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UBZ9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human REV1 Homolog expressed in: E.coli

Recombinant REV1 Homolog (REV1)

4-RPM132Hu03
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UBZ9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human REV1 Homolog expressed in: E.coli

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat)

4-MAM132Hu21
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1)

Human REV1 Homolog (REV1) Protein

20-abx068903
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human REV1 Homolog (REV1) Protein

20-abx068904
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human REV1 Homolog (REV1) Protein

20-abx068905
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human REV1 Antibody

32076-05111 150 ug
EUR 261

REV1 Conjugated Antibody

C44849 100ul
EUR 397

Anti-REV1 antibody

STJ110791 100 µl
EUR 277
Description: This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA.

Anti-REV1 antibody

STJ191912 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to REV1

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), APC

4-MAM132Hu21-APC
  • EUR 380.00
  • EUR 3779.00
  • EUR 1038.00
  • EUR 490.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with APC.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), Biotinylated

4-MAM132Hu21-Biotin
  • EUR 337.00
  • EUR 2829.00
  • EUR 819.00
  • EUR 417.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with Biotin.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), Cy3

4-MAM132Hu21-Cy3
  • EUR 465.00
  • EUR 4997.00
  • EUR 1343.00
  • EUR 612.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with Cy3.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), FITC

4-MAM132Hu21-FITC
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with FITC.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), HRP

4-MAM132Hu21-HRP
  • EUR 346.00
  • EUR 3291.00
  • EUR 916.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with HRP.

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), PE

4-MAM132Hu21-PE
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with PE.

REV1 siRNA

20-abx931293
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REV1 siRNA

20-abx931294
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-REV1

YF-PA26188 50 ul
EUR 334
Description: Mouse polyclonal to REV1

REV1 Homolog (REV1) Monoclonal Antibody (Human, Rat), APC-Cy7

4-MAM132Hu21-APC-Cy7
  • EUR 641.00
  • EUR 7438.00
  • EUR 1957.00
  • EUR 860.00
  • EUR 349.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser301~Lys478
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Rat REV1 Homolog (REV1). This antibody is labeled with APC-Cy7.

REV1 Antibody, HRP conjugated

1-CSB-PA883372LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

REV1 Antibody, FITC conjugated

1-CSB-PA883372LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

REV1 Antibody, Biotin conjugated

1-CSB-PA883372LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against REV1. Recognizes REV1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

REV1 Blocking Peptide

DF2581-BP 1mg
EUR 195

REV1 Polymerase (Recombinant)

20-abx073440
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

REV1 cloning plasmid

CSB-CL883372HU-10ug 10ug
EUR 1322
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3753
  • Sequence: atgaggcgaggtggatggaggaagcgagctgaaaatgatggctgggaaacatggggtgggtatatggctgccaaggtccagaaattggaggaacagtttcgatcagatgctgctatgcagaaggatgggacttcatctacaatttttagtggagttgccatctatgttaatggat
  • Show more
Description: A cloning plasmid for the REV1 gene.

Human REV1 Antibody (Biotin Conjugate)

32076-05121 150 ug
EUR 369

Human REV1 (DNA repair protein REV1) ELISA Kit (CUSTOM)

ELI-52641h 96 Tests
EUR 824

Chicken REV1 (DNA repair protein REV1) ELISA Kit (CUSTOM)

ELI-35653c 96 Tests
EUR 928

Mouse REV1 (DNA repair protein REV1) ELISA Kit (CUSTOM)

ELI-41191m 96 Tests
EUR 865

REV1 protein (His tag)

80R-3801 100 ug
EUR 327
Description: Purified recombinant REV1 protein (His tag)

Mouse REV1 shRNA Plasmid

20-abx974649
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human REV1 shRNA Plasmid

20-abx959774
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCD513B-1-Rev1 Plasmid

PVTB70014-4a 2 ug
EUR 356

Human REV1 AssayLite Antibody (FITC Conjugate)

32076-05141 150 ug
EUR 428

Human REV1 AssayLite Antibody (RPE Conjugate)

32076-05151 150 ug
EUR 428

Human REV1 AssayLite Antibody (APC Conjugate)

32076-05161 150 ug
EUR 428

Human REV1 AssayLite Antibody (PerCP Conjugate)

32076-05171 150 ug
EUR 471

Rev1 ORF Vector (Rat) (pORF)

ORF074711 1.0 ug DNA
EUR 506

REV1 ORF Vector (Human) (pORF)

ORF014272 1.0 ug DNA
EUR 354

Rev1 ORF Vector (Mouse) (pORF)

ORF055895 1.0 ug DNA
EUR 506

REV1 Polymerase Human Recombinant Protein

PROTQ9UBZ9 Regular: 20ug
EUR 317
Description: REV1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 227 amino acids (51-256) and having a molecular mass of 25.2kDa.;REV1 is fused to a 21 amino acid His-tag at N-terminus.

Rev1 sgRNA CRISPR Lentivector set (Rat)

K6298601 3 x 1.0 ug
EUR 339

REV1 sgRNA CRISPR Lentivector set (Human)

K1810001 3 x 1.0 ug
EUR 339

Rev1 sgRNA CRISPR Lentivector set (Mouse)

K3944401 3 x 1.0 ug
EUR 339

Recombinant human DNA repair protein REV1

P2230 100ug Ask for price
  • Uniprot ID: Q9UBZ9
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human DNA repair protein REV1

Rev1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6298602 1.0 ug DNA
EUR 154

Rev1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6298603 1.0 ug DNA
EUR 154

Rev1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6298604 1.0 ug DNA
EUR 154

REV1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1810002 1.0 ug DNA
EUR 154

REV1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1810003 1.0 ug DNA
EUR 154

REV1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1810004 1.0 ug DNA
EUR 154

Rev1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3944402 1.0 ug DNA
EUR 154

Rev1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3944403 1.0 ug DNA
EUR 154

Rev1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3944404 1.0 ug DNA
EUR 154

REV1 Protein Vector (Rat) (pPB-C-His)

PV298842 500 ng
EUR 1191

REV1 Protein Vector (Rat) (pPB-N-His)

PV298843 500 ng
EUR 1191

REV1 Protein Vector (Rat) (pPM-C-HA)

PV298844 500 ng
EUR 1191

REV1 Protein Vector (Rat) (pPM-C-His)

PV298845 500 ng
EUR 1191

REV1 Protein Vector (Human) (pPB-C-His)

PV057085 500 ng
EUR 481

REV1 Protein Vector (Human) (pPB-N-His)

PV057086 500 ng
EUR 481

REV1 Protein Vector (Human) (pPM-C-HA)

PV057087 500 ng
EUR 481

REV1 Protein Vector (Human) (pPM-C-His)

PV057088 500 ng
EUR 481

REV1 Protein Vector (Mouse) (pPB-C-His)

PV223578 500 ng
EUR 1065

REV1 Protein Vector (Mouse) (pPB-N-His)

PV223579 500 ng
EUR 1065

REV1 Protein Vector (Mouse) (pPM-C-HA)

PV223580 500 ng
EUR 1065

REV1 Protein Vector (Mouse) (pPM-C-His)

PV223581 500 ng
EUR 1065

Recombinant Human REV1 Protein, His, E.coli-1mg

QP13301-1mg 1mg
EUR 2757

Recombinant Human REV1 Protein, His, E.coli-20ug

QP13301-20ug 20ug
EUR 201

Recombinant Human REV1 Protein, His, E.coli-5ug

QP13301-5ug 5ug
EUR 155

Rev1 3'UTR Luciferase Stable Cell Line

TU117741 1.0 ml Ask for price

Rev1 3'UTR GFP Stable Cell Line

TU167741 1.0 ml Ask for price

Rev1 3'UTR Luciferase Stable Cell Line

TU217490 1.0 ml Ask for price

Rev1 3'UTR GFP Stable Cell Line

TU267490 1.0 ml Ask for price

REV1 3'UTR GFP Stable Cell Line

TU069769 1.0 ml
EUR 2333

REV1 3'UTR Luciferase Stable Cell Line

TU019769 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

REV1 Rabbit Polyclonal Antibody