RIPK3 Rabbit Polyclonal Antibody

RIPK3 Rabbit Polyclonal Antibody

RIPK3 Polyclonal Antibody

ES10828-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RIPK3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RIPK3 Rabbit pAb

A12996-100ul 100 ul
EUR 308

RIPK3 Rabbit pAb

A12996-200ul 200 ul
EUR 459

RIPK3 Rabbit pAb

A12996-20ul 20 ul
EUR 183

RIPK3 Rabbit pAb

A12996-50ul 50 ul
EUR 223

Polyclonal RIPK3 Antibody (C-term)

APR03974G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 (C-term). This antibody is tested and proven to work in the following applications:

RIPK3 Polyclonal Antibody, Biotin Conjugated

A60611 100 µg
EUR 570.55
Description: fast delivery possible

RIPK3 Polyclonal Antibody, FITC Conjugated

A60612 100 µg
EUR 570.55
Description: reagents widely cited

RIPK3 Polyclonal Antibody, HRP Conjugated

A60613 100 µg
EUR 570.55
Description: Ask the seller for details

RIPK3 antibody

20R-1514 100 ug
EUR 673
Description: Rabbit polyclonal RIPK3 antibody

RIPK3 antibody

70R-19905 50 ul
EUR 435
Description: Rabbit polyclonal RIPK3 antibody

RIPK3 antibody

38654-100ul 100ul
EUR 252

RIPK3 Antibody

1-CSB-PA897497ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK3 Antibody

1-CSB-PA897497LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:200-1:500

RIPK3 Antibody

DF10141 200ul
EUR 304
Description: RIPK3 Antibody detects endogenous levels of total RIPK3.

RIPK3 Antibody

DF7339 200ul
EUR 304
Description: RIPK3 Antibody detects endogenous levels of total RIPK3.

RIPK3 Antibody

AF4808 200ul
EUR 376
Description: RIPK3 Antibody detects endogenous levels of RIPK3.

RIPK3 Antibody

1-CSB-PA019737GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK3 Antibody

ABD10141 100 ug
EUR 438

RIPK3 Antibody

ABD7339 100 ug
EUR 438

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Hu-48T 48T
EUR 517
  • Should the Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Hu-96T 96T
EUR 673
  • Should the Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Ra-48T 48T
EUR 549
  • Should the Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

DLR-RIPK3-Ra-96T 96T
EUR 718
  • Should the Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Hu-48Tests 48 Tests
EUR 544

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Hu-96Tests 96 Tests
EUR 756

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Ra-48Tests 48 Tests
EUR 583

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RDR-RIPK3-Ra-96Tests 96 Tests
EUR 811

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Hu-48Tests 48 Tests
EUR 521

Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Hu-96Tests 96 Tests
EUR 723

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Ra-48Tests 48 Tests
EUR 557

Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit

RD-RIPK3-Ra-96Tests 96 Tests
EUR 775

Polyclonal RIPK3 / RIP3 Antibody (aa480-530)

APR02432G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 / RIP3 (aa480-530). This antibody is tested and proven to work in the following applications:

Polyclonal RIPK3 antibody - N-terminal region

APR00553G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 - N-terminal region. This antibody is tested and proven to work in the following applications:

RIPK3 Conjugated Antibody

C38654 100ul
EUR 397

Anti-RIPK3 antibody

STJ27384 100 µl
EUR 277
Description: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor.

Anti-RIPK3 antibody

STJ114965 100 µl
EUR 277
Description: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor.

Anti-RIPK3 antibody

STJ191986 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RIPK3

Anti-RIPK3 Antibody

STJ502804 100 µg
EUR 476

Anti-RIPK3 Antibody

STJ502805 100 µg
EUR 476

Ripk3/ Rat Ripk3 ELISA Kit

ELI-45139r 96 Tests
EUR 886

RIPK3 siRNA

20-abx904586
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK3 siRNA

20-abx931566
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK3 siRNA

20-abx931567
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK3 Antibody, HRP conjugated

1-CSB-PA897497LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK3 Antibody, FITC conjugated

1-CSB-PA897497LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK3 Antibody, Biotin conjugated

1-CSB-PA897497LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-RIPK3(Ser316) Antibody

AF4508 200ul
EUR 376
Description: Phospho-RIPK3(Ser316) Antibody detects endogenous levels of RIPK3 only when phosphorylated at Ser316.

Anti-RIP3/RIPK3 Antibody

PA2242 100ug/vial
EUR 294

Anti-RIPK3 Antibody (Biotin)

STJ502806 100 µg
EUR 586

Anti-RIPK3 Antibody (FITC)

STJ502807 100 µg
EUR 586

Anti-RIPK3 Antibody (Biotin)

STJ502808 100 µg
EUR 586

Anti-RIPK3 Antibody (FITC)

STJ502809 100 µg
EUR 586

RIPK3 cloning plasmid

CSB-CL897497HU-10ug 10ug
EUR 255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 522
  • Sequence: atgtcgtgcgtcaagttatggcccagcggtgcccccgcccccttggtgtccatcgaggaactggagaaccaggagctcgtcggcaaaggcgggttcggcacagtgttccgggcgcaacataggaagtggggctacgatgtggcggtcaagatcgtaaactcgaaggcgatatccag
  • Show more
Description: A cloning plasmid for the RIPK3 gene.

RIPK3 Blocking Peptide

DF10141-BP 1mg
EUR 195

RIPK3 Blocking Peptide

DF7339-BP 1mg
EUR 195

RIPK3 Blocking Peptide

20-abx161414
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RIPK3 Blocking Peptide

AF4808-BP 1mg
EUR 195

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse)

4-PAE639Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3)

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat)

4-PAE639Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3)

Human RIPK3 ELISA KIT

ELI-30289h 96 Tests
EUR 824

Mouse Ripk3 ELISA KIT

ELI-30290m 96 Tests
EUR 865

RIPK3 ELISA KIT|Human

EF010939 96 Tests
EUR 689

Rat RIPK3 shRNA Plasmid

20-abx987959
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RIPK3 shRNA Plasmid

20-abx974829
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RIPK3 shRNA Plasmid

20-abx957541
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-RIPK3 Plasmid

PVTB00720 2 ug
EUR 356

pCMV-HA-RIPK3 Plasmid

PVTB00720-2a 2 ug
EUR 356

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), APC

4-PAE639Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), Biotinylated

4-PAE639Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Biotin.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), Cy3

4-PAE639Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Cy3.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), FITC

4-PAE639Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with FITC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), HRP

4-PAE639Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with HRP.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), PE

4-PAE639Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Leu16~Cys239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with PE.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), APC

4-PAE639Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), Biotinylated

4-PAE639Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Biotin.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), Cy3

4-PAE639Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Cy3.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), FITC

4-PAE639Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with FITC.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), HRP

4-PAE639Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with HRP.

Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), PE

4-PAE639Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RIPK3 (Val50~Pro272)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with PE.

Phospho-RIPK3(Ser316) Blocking Peptide

AF4508-BP 1mg
EUR 195

Ripk3 ORF Vector (Rat) (pORF)

ORF075394 1.0 ug DNA
EUR 506

RIPK3 ORF Vector (Human) (pORF)

ORF008829 1.0 ug DNA
EUR 95

Ripk3 ORF Vector (Mouse) (pORF)

ORF056096 1.0 ug DNA
EUR 506

Ripk3 ORF Vector (Mouse) (pORF)

ORF056097 1.0 ug DNA
EUR 506

RIPK3 Rabbit Polyclonal Antibody