RTDR1 Rabbit Polyclonal Antibody

RTDR1 Rabbit Polyclonal Antibody

RTDR1 Polyclonal Antibody

ES10667-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RTDR1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RTDR1 Polyclonal Antibody

ES10667-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RTDR1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RTDR1 Antibody

44506-100ul 100ul
EUR 252

RTDR1 Antibody

44506-50ul 50ul
EUR 187

RTDR1 Antibody

DF10086 200ul
EUR 304
Description: RTDR1 Antibody detects endogenous levels of total RTDR1.

RTDR1 antibody

70R-3551 50 ug
EUR 467
Description: Rabbit polyclonal RTDR1 antibody raised against the middle region of RTDR1

RTDR1 antibody

70R-3433 50 ug
EUR 467
Description: Rabbit polyclonal RTDR1 antibody raised against the N terminal of RTDR1

RTDR1 Antibody

20-abx121216
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RTDR1 Antibody

ABD10086 100 ug
EUR 438

Polyclonal RTDR1 Antibody (N-term)

APR03795G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RTDR1 (N-term). This antibody is tested and proven to work in the following applications:

RTDR1 Conjugated Antibody

C44506 100ul
EUR 397

Anti-RTDR1 antibody

STJ191825 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RTDR1

RTDR1 siRNA

20-abx932235
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RTDR1

YF-PA18397 50 ul
EUR 363
Description: Mouse polyclonal to RTDR1

RTDR1 Blocking Peptide

33R-3896 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTDR1 antibody, catalog no. 70R-3551

RTDR1 Blocking Peptide

33R-5675 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTDR1 antibody, catalog no. 70R-3433

RTDR1 Blocking Peptide

DF10086-BP 1mg
EUR 195

RTDR1 Blocking Peptide

20-abx161216
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RTDR1 cloning plasmid

CSB-CL887042HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1047
  • Sequence: atggcccattcccagaactccttggagcttcccattaacatcaatgccacccagattaccactgcctatggccatcgggccctgcccaagctgaaggaggagctgcagtcagaggacctccagacgaggcagaaagccctcatggccctgtgtgacctcatgcatgaccccgagt
  • Show more
Description: A cloning plasmid for the RTDR1 gene.

Anti-RTDR1 (3B6)

YF-MA18170 100 ug
EUR 363
Description: Mouse monoclonal to RTDR1

Human RTDR1 shRNA Plasmid

20-abx958999
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RTDR1 Recombinant Protein (Human)

RP027370 100 ug Ask for price

RTDR1 Recombinant Protein (Rat)

RP227207 100 ug Ask for price

RTDR1 Recombinant Protein (Mouse)

RP169520 100 ug Ask for price

RTDR1 Recombinant Protein (Mouse)

RP169523 100 ug Ask for price

RTDR1 Recombinant Protein (Mouse)

RP169526 100 ug Ask for price

RTDR1 Recombinant Protein (Mouse)

RP169529 100 ug Ask for price

Rtdr1 ORF Vector (Rat) (pORF)

ORF075737 1.0 ug DNA
EUR 506

RTDR1 ORF Vector (Human) (pORF)

ORF009124 1.0 ug DNA
EUR 95

Rtdr1 ORF Vector (Mouse) (pORF)

ORF056508 1.0 ug DNA
EUR 506

Rtdr1 ORF Vector (Mouse) (pORF)

ORF056509 1.0 ug DNA
EUR 506

Rtdr1 ORF Vector (Mouse) (pORF)

ORF056510 1.0 ug DNA
EUR 506

Rtdr1 ORF Vector (Mouse) (pORF)

ORF056511 1.0 ug DNA
EUR 506

Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody

abx027299-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody

abx027299-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody

20-abx218401
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rtdr1 sgRNA CRISPR Lentivector set (Rat)

K6042501 3 x 1.0 ug
EUR 339

Rtdr1 sgRNA CRISPR Lentivector set (Mouse)

K3109301 3 x 1.0 ug
EUR 339

RTDR1 sgRNA CRISPR Lentivector set (Human)

K2075601 3 x 1.0 ug
EUR 339

Rtdr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6042502 1.0 ug DNA
EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6042503 1.0 ug DNA
EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6042504 1.0 ug DNA
EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3109302 1.0 ug DNA
EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3109303 1.0 ug DNA
EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3109304 1.0 ug DNA
EUR 154

RTDR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2075602 1.0 ug DNA
EUR 154

RTDR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2075603 1.0 ug DNA
EUR 154

RTDR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2075604 1.0 ug DNA
EUR 154

RTDR1 Protein Vector (Rat) (pPB-C-His)

PV302946 500 ng
EUR 603

RTDR1 Protein Vector (Rat) (pPB-N-His)

PV302947 500 ng
EUR 603

RTDR1 Protein Vector (Rat) (pPM-C-HA)

PV302948 500 ng
EUR 603

RTDR1 Protein Vector (Rat) (pPM-C-His)

PV302949 500 ng
EUR 603

RTDR1 Protein Vector (Mouse) (pPB-C-His)

PV226030 500 ng
EUR 603

RTDR1 Protein Vector (Mouse) (pPB-N-His)

PV226031 500 ng
EUR 603

RTDR1 Rabbit Polyclonal Antibody