Da vinci european bio bank

RTDR1 Rabbit Polyclonal Antibody

RTDR1 Polyclonal Antibody
ES10667-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RTDR1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RTDR1 Polyclonal Antibody
ES10667-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RTDR1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RTDR1 Antibody
44506-100ul	SAB	100ul	EUR 252

RTDR1 Antibody
44506-50ul	SAB	50ul	EUR 187

RTDR1 Antibody
DF10086	Affbiotech	200ul	EUR 304
Description: RTDR1 Antibody detects endogenous levels of total RTDR1.

RTDR1 antibody
70R-3551	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RTDR1 antibody raised against the middle region of RTDR1

RTDR1 antibody
70R-3433	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RTDR1 antibody raised against the N terminal of RTDR1

RTDR1 Antibody
20-abx121216	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

RTDR1 Antibody
ABD10086	Lifescience Market	100 ug	EUR 438

Polyclonal RTDR1 Antibody (N-term)
APR03795G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RTDR1 (N-term). This antibody is tested and proven to work in the following applications:

RTDR1 Conjugated Antibody
C44506	SAB	100ul	EUR 397

Anti-RTDR1 antibody
STJ191825	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RTDR1

RTDR1 siRNA
20-abx932235	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RTDR1
YF-PA18397	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to RTDR1

RTDR1 Blocking Peptide
33R-3896	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTDR1 antibody, catalog no. 70R-3551

RTDR1 Blocking Peptide
33R-5675	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTDR1 antibody, catalog no. 70R-3433

RTDR1 Blocking Peptide
DF10086-BP	Affbiotech	1mg	EUR 195

RTDR1 Blocking Peptide
20-abx161216	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RTDR1 cloning plasmid
CSB-CL887042HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1047 Sequence: atggcccattcccagaactccttggagcttcccattaacatcaatgccacccagattaccactgcctatggccatcgggccctgcccaagctgaaggaggagctgcagtcagaggacctccagacgaggcagaaagccctcatggccctgtgtgacctcatgcatgaccccgagt Show more
Description: A cloning plasmid for the RTDR1 gene.

Anti-RTDR1 (3B6)
YF-MA18170	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RTDR1

Human RTDR1 shRNA Plasmid
20-abx958999	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RTDR1 Recombinant Protein (Human)
RP027370	ABM	100 ug	Ask for price

RTDR1 Recombinant Protein (Rat)
RP227207	ABM	100 ug	Ask for price

RTDR1 Recombinant Protein (Mouse)
RP169520	ABM	100 ug	Ask for price

RTDR1 Recombinant Protein (Mouse)
RP169523	ABM	100 ug	Ask for price

RTDR1 Recombinant Protein (Mouse)
RP169526	ABM	100 ug	Ask for price

RTDR1 Recombinant Protein (Mouse)
RP169529	ABM	100 ug	Ask for price

Rtdr1 ORF Vector (Rat) (pORF)
ORF075737	ABM	1.0 ug DNA	EUR 506

RTDR1 ORF Vector (Human) (pORF)
ORF009124	ABM	1.0 ug DNA	EUR 95

Rtdr1 ORF Vector (Mouse) (pORF)
ORF056508	ABM	1.0 ug DNA	EUR 506

Rtdr1 ORF Vector (Mouse) (pORF)
ORF056509	ABM	1.0 ug DNA	EUR 506

Rtdr1 ORF Vector (Mouse) (pORF)
ORF056510	ABM	1.0 ug DNA	EUR 506

Rtdr1 ORF Vector (Mouse) (pORF)
ORF056511	ABM	1.0 ug DNA	EUR 506

Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody
abx027299-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody
abx027299-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody
20-abx218401	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Rtdr1 sgRNA CRISPR Lentivector set (Rat)
K6042501	ABM	3 x 1.0 ug	EUR 339

Rtdr1 sgRNA CRISPR Lentivector set (Mouse)
K3109301	ABM	3 x 1.0 ug	EUR 339

RTDR1 sgRNA CRISPR Lentivector set (Human)
K2075601	ABM	3 x 1.0 ug	EUR 339

Rtdr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6042502	ABM	1.0 ug DNA	EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6042503	ABM	1.0 ug DNA	EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6042504	ABM	1.0 ug DNA	EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3109302	ABM	1.0 ug DNA	EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3109303	ABM	1.0 ug DNA	EUR 154

Rtdr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3109304	ABM	1.0 ug DNA	EUR 154

RTDR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2075602	ABM	1.0 ug DNA	EUR 154

RTDR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2075603	ABM	1.0 ug DNA	EUR 154

RTDR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2075604	ABM	1.0 ug DNA	EUR 154

RTDR1 Protein Vector (Rat) (pPB-C-His)
PV302946	ABM	500 ng	EUR 603

RTDR1 Protein Vector (Rat) (pPB-N-His)
PV302947	ABM	500 ng	EUR 603

RTDR1 Protein Vector (Rat) (pPM-C-HA)
PV302948	ABM	500 ng	EUR 603

RTDR1 Protein Vector (Rat) (pPM-C-His)
PV302949	ABM	500 ng	EUR 603

RTDR1 Protein Vector (Mouse) (pPB-C-His)
PV226030	ABM	500 ng	EUR 603

RTDR1 Protein Vector (Mouse) (pPB-N-His)
PV226031	ABM	500 ng	EUR 603

RTDR1 Rabbit Polyclonal Antibody