SUMO4 Rabbit Polyclonal Antibody

SUMO4 Rabbit Polyclonal Antibody

SUMO4 Polyclonal Antibody

ABP60555-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SUMO4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO4 from Human. This SUMO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO4 protein

SUMO4 Polyclonal Antibody

ABP60555-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SUMO4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO4 from Human. This SUMO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO4 protein

SUMO4 Rabbit pAb

A3100-100ul 100 ul
EUR 308

SUMO4 Rabbit pAb

A3100-200ul 200 ul
EUR 459

SUMO4 Rabbit pAb

A3100-20ul 20 ul
EUR 183

SUMO4 Rabbit pAb

A3100-50ul 50 ul
EUR 223

SUMO4 Rabbit pAb

A7517-100ul 100 ul
EUR 308

SUMO4 Rabbit pAb

A7517-200ul 200 ul
EUR 459

SUMO4 Rabbit pAb

A7517-20ul 20 ul
EUR 183

SUMO4 Rabbit pAb

A7517-50ul 50 ul
EUR 223

Polyclonal SUMO4 Antibody (Center)

APR03721G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO4 (Center). This antibody is tested and proven to work in the following applications:

Anti-SUMO4 Rabbit Monoclonal Antibody

M06740 100ug/vial
EUR 397
Description: Rabbit Monoclonal SUMO4 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

SUMO4 Antibody

ABD7186 100 ug
EUR 438

SUMO4 antibody

38579-100ul 100ul
EUR 252

SUMO4 Antibody

49293-100ul 100ul
EUR 333

SUMO4 Antibody

49293-50ul 50ul
EUR 239

SUMO4 Antibody

DF7186 200ul
EUR 304
Description: SUMO4 Antibody detects endogenous levels of total SUMO4.

SUMO4 Antibody

1-CSB-PA718803ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO4. Recognizes SUMO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal SUMO4 Antibody (V55 Mutant)

APR03726G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO4 (V55 Mutant). This antibody is tested and proven to work in the following applications:

SUMO4 Conjugated Antibody

C38579 100ul
EUR 397

SUMO4 Conjugated Antibody

C49293 100ul
EUR 397

Anti-SUMO4 antibody

STJ29653 100 µl
EUR 277
Description: This gene is a member of the SUMO gene family. This family of genes encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability, or activity. The protein described in this record is located in the cytoplasm and specifically modifies IKBA, leading to negative regulation of NF-kappa-B-dependent transcription of the IL12B gene. A specific polymorphism in this SUMO gene, which leads to the M55V substitution, has been associated with type I diabetes. The RefSeq contains this polymorphism.

Anti-SUMO4 antibody

STJ25751 100 µl
EUR 277
Description: This gene is a member of the SUMO gene family. This family of genes encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability, or activity. The protein described in this record is located in the cytoplasm and specifically modifies IKBA, leading to negative regulation of NF-kappa-B-dependent transcription of the IL12B gene. A specific polymorphism in this SUMO gene, which leads to the M55V substitution, has been associated with type I diabetes. The RefSeq contains this polymorphism.

Anti-SUMO4 antibody

STJ192008 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SUMO4

Polyclonal SUMO4 Antibody (M55 Wild type)

APR03725G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO4 (M55 Wild type). This antibody is tested and proven to work in the following applications:

SUMO4 siRNA

20-abx935670
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SUMO4

YF-PA23068 50 ul
EUR 363
Description: Mouse polyclonal to SUMO4

anti-SUMO4

YF-PA23069 50 ug
EUR 363
Description: Mouse polyclonal to SUMO4

SUMO4 (V55 Mutant) Antibody

abx026940-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SUMO4 (V55 Mutant) Antibody

abx026940-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SUMO4 recombinant monoclonal antibody

A5196 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human SUMO4 for WB, IF,ELISA

SUMO2/SUMO3/SUMO4 Antibody

36877-100ul 100ul
EUR 252

Rabbit Anti-SUMO4 monoclonal antibody, clone KK196-12

CABT-L851 100 ul
EUR 777

SUMO4 Blocking Peptide

DF7186-BP 1mg
EUR 195

SUMO4 cloning plasmid

CSB-CL718803HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atggccaacgaaaagcccacagaagaagtcaagactgagaacaacaatcatattaatttgaaggtggcgggacaggatggttctgtggtgcagtttaagattaagaggcagacaccacttagtaaactaatgaaagcctattgtgaaccacggggattgtcagtgaagcagatcag
  • Show more
Description: A cloning plasmid for the SUMO4 gene.

Anti-SUMO4 (1D3)

YF-MA20632 100 ug
EUR 363
Description: Mouse monoclonal to SUMO4

SUMO2/SUMO3/SUMO4 Conjugated Antibody

C36877 100ul
EUR 397

SUMO4 (M55 Wild type) Antibody

abx026939-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SUMO4 (M55 Wild type) Antibody

abx026939-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human SUMO4 shRNA Plasmid

20-abx967724
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SUMO4 Recombinant Protein (Human)

RP043861 100 ug Ask for price

Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody

20-abx002229
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody

20-abx142252
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody

abx037310-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody

20-abx007010
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody

abx026932-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody

abx026932-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody

20-abx320411
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

SUMO4 ORF Vector (Human) (pORF)

ORF014621 1.0 ug DNA
EUR 354

SUMO4 sgRNA CRISPR Lentivector set (Human)

K2314701 3 x 1.0 ug
EUR 339

SUMO4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2314702 1.0 ug DNA
EUR 154

SUMO4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2314703 1.0 ug DNA
EUR 154

SUMO4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2314704 1.0 ug DNA
EUR 154

Human Small ubiquitin-related modifier 4 (SUMO4)

1-CSB-EP718803HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Small ubiquitin-related modifier 4(SUMO4) expressed in E.coli

SUMO4 Protein Vector (Human) (pPB-C-His)

PV058481 500 ng
EUR 481

SUMO4 Protein Vector (Human) (pPB-N-His)

PV058482 500 ng
EUR 481

SUMO4 Protein Vector (Human) (pPM-C-HA)

PV058483 500 ng
EUR 481

SUMO4 Protein Vector (Human) (pPM-C-His)

PV058484 500 ng
EUR 481

SUMO4 3'UTR GFP Stable Cell Line

TU074934 1.0 ml
EUR 1394

SUMO4 3'UTR Luciferase Stable Cell Line

TU024934 1.0 ml
EUR 1394

Porcine Small ubiquitin- related modifier 4, SUMO4 ELISA KIT

ELI-52174p 96 Tests
EUR 928

Human Small ubiquitin- related modifier 4, SUMO4 ELISA KIT

ELI-41634h 96 Tests
EUR 824

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SUMO4 Rabbit Polyclonal Antibody