SUMO4 Rabbit Polyclonal Antibody
SUMO4 Polyclonal Antibody |
ABP60555-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SUMO4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SUMO4 from Human. This SUMO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO4 protein |
SUMO4 Polyclonal Antibody |
ABP60555-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SUMO4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SUMO4 from Human. This SUMO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO4 protein |
SUMO4 Rabbit pAb |
A3100-100ul |
Abclonal |
100 ul |
EUR 308 |
SUMO4 Rabbit pAb |
A3100-200ul |
Abclonal |
200 ul |
EUR 459 |
SUMO4 Rabbit pAb |
A3100-20ul |
Abclonal |
20 ul |
EUR 183 |
SUMO4 Rabbit pAb |
A3100-50ul |
Abclonal |
50 ul |
EUR 223 |
SUMO4 Rabbit pAb |
A7517-100ul |
Abclonal |
100 ul |
EUR 308 |
SUMO4 Rabbit pAb |
A7517-200ul |
Abclonal |
200 ul |
EUR 459 |
SUMO4 Rabbit pAb |
A7517-20ul |
Abclonal |
20 ul |
EUR 183 |
SUMO4 Rabbit pAb |
A7517-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal SUMO4 Antibody (Center) |
APR03721G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO4 (Center). This antibody is tested and proven to work in the following applications: |
Anti-SUMO4 Rabbit Monoclonal Antibody |
M06740 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal SUMO4 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
SUMO4 antibody |
38579-100ul |
SAB |
100ul |
EUR 252 |
SUMO4 Antibody |
49293-100ul |
SAB |
100ul |
EUR 333 |
SUMO4 Antibody |
49293-50ul |
SAB |
50ul |
EUR 239 |
SUMO4 Antibody |
DF7186 |
Affbiotech |
200ul |
EUR 304 |
Description: SUMO4 Antibody detects endogenous levels of total SUMO4. |
SUMO4 Antibody |
1-CSB-PA718803ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SUMO4. Recognizes SUMO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal SUMO4 Antibody (V55 Mutant) |
APR03726G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO4 (V55 Mutant). This antibody is tested and proven to work in the following applications: |
SUMO4 Conjugated Antibody |
C38579 |
SAB |
100ul |
EUR 397 |
SUMO4 Conjugated Antibody |
C49293 |
SAB |
100ul |
EUR 397 |
Anti-SUMO4 antibody |
STJ29653 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the SUMO gene family. This family of genes encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability, or activity. The protein described in this record is located in the cytoplasm and specifically modifies IKBA, leading to negative regulation of NF-kappa-B-dependent transcription of the IL12B gene. A specific polymorphism in this SUMO gene, which leads to the M55V substitution, has been associated with type I diabetes. The RefSeq contains this polymorphism. |
Anti-SUMO4 antibody |
STJ25751 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the SUMO gene family. This family of genes encode small ubiquitin-related modifiers that are attached to proteins and control the target proteins' subcellular localization, stability, or activity. The protein described in this record is located in the cytoplasm and specifically modifies IKBA, leading to negative regulation of NF-kappa-B-dependent transcription of the IL12B gene. A specific polymorphism in this SUMO gene, which leads to the M55V substitution, has been associated with type I diabetes. The RefSeq contains this polymorphism. |
Anti-SUMO4 antibody |
STJ192008 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SUMO4 |
Polyclonal SUMO4 Antibody (M55 Wild type) |
APR03725G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO4 (M55 Wild type). This antibody is tested and proven to work in the following applications: |
SUMO4 siRNA |
20-abx935670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SUMO4 |
YF-PA23068 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to SUMO4 |
anti-SUMO4 |
YF-PA23069 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SUMO4 |
SUMO4 (V55 Mutant) Antibody |
abx026940-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
SUMO4 (V55 Mutant) Antibody |
abx026940-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
SUMO4 recombinant monoclonal antibody |
A5196 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human SUMO4 for WB, IF,ELISA |
SUMO2/SUMO3/SUMO4 Antibody |
36877-100ul |
SAB |
100ul |
EUR 252 |
SUMO4 Blocking Peptide |
DF7186-BP |
Affbiotech |
1mg |
EUR 195 |
SUMO4 cloning plasmid |
CSB-CL718803HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 288
- Sequence: atggccaacgaaaagcccacagaagaagtcaagactgagaacaacaatcatattaatttgaaggtggcgggacaggatggttctgtggtgcagtttaagattaagaggcagacaccacttagtaaactaatgaaagcctattgtgaaccacggggattgtcagtgaagcagatcag
- Show more
|
Description: A cloning plasmid for the SUMO4 gene. |
Anti-SUMO4 (1D3) |
YF-MA20632 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SUMO4 |
SUMO2/SUMO3/SUMO4 Conjugated Antibody |
C36877 |
SAB |
100ul |
EUR 397 |
SUMO4 (M55 Wild type) Antibody |
abx026939-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
SUMO4 (M55 Wild type) Antibody |
abx026939-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Human SUMO4 shRNA Plasmid |
20-abx967724 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SUMO4 Recombinant Protein (Human) |
RP043861 |
ABM |
100 ug |
Ask for price |
Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody |
20-abx002229 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody |
20-abx142252 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody |
abx037310-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody |
20-abx007010 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody |
abx026932-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody |
abx026932-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 4 (SUMO4) Antibody |
20-abx320411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SUMO4 ORF Vector (Human) (pORF) |
ORF014621 |
ABM |
1.0 ug DNA |
EUR 354 |
SUMO4 sgRNA CRISPR Lentivector set (Human) |
K2314701 |
ABM |
3 x 1.0 ug |
EUR 339 |
SUMO4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2314702 |
ABM |
1.0 ug DNA |
EUR 154 |
SUMO4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2314703 |
ABM |
1.0 ug DNA |
EUR 154 |
SUMO4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2314704 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Small ubiquitin-related modifier 4 (SUMO4) |
1-CSB-EP718803HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 37.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Small ubiquitin-related modifier 4(SUMO4) expressed in E.coli |
SUMO4 Protein Vector (Human) (pPB-C-His) |
PV058481 |
ABM |
500 ng |
EUR 481 |
SUMO4 Protein Vector (Human) (pPB-N-His) |
PV058482 |
ABM |
500 ng |
EUR 481 |
SUMO4 Protein Vector (Human) (pPM-C-HA) |
PV058483 |
ABM |
500 ng |
EUR 481 |
SUMO4 Protein Vector (Human) (pPM-C-His) |
PV058484 |
ABM |
500 ng |
EUR 481 |
SUMO4 3'UTR GFP Stable Cell Line |
TU074934 |
ABM |
1.0 ml |
EUR 1394 |
SUMO4 3'UTR Luciferase Stable Cell Line |
TU024934 |
ABM |
1.0 ml |
EUR 1394 |
Porcine Small ubiquitin- related modifier 4, SUMO4 ELISA KIT |
ELI-52174p |
Lifescience Market |
96 Tests |
EUR 928 |
Human Small ubiquitin- related modifier 4, SUMO4 ELISA KIT |
ELI-41634h |
Lifescience Market |
96 Tests |
EUR 824 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SUMO4 Rabbit Polyclonal Antibody