TCHP Rabbit Polyclonal Antibody

TCHP Rabbit Polyclonal Antibody

TCHP Polyclonal Antibody

A61266 100 µg
EUR 570.55
Description: fast delivery possible

TCHP Antibody

ABD13283 100 ug
EUR 438

TCHP Antibody

ABD2457 100 ug
EUR 438

TCHP Antibody

44773-100ul 100ul
EUR 252

TCHP Antibody

44773-50ul 50ul
EUR 187

TCHP antibody

70R-10097 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TCHP antibody

TCHP Antibody

1-CSB-PA874804LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500

TCHP Antibody

DF2457 200ul
EUR 304
Description: TCHP antibody detects endogenous levels of total TCHP.

TCHP Polyclonal Antibody, Biotin Conjugated

A61267 100 µg
EUR 570.55
Description: reagents widely cited

TCHP Polyclonal Antibody, FITC Conjugated

A61268 100 µg
EUR 570.55
Description: Ask the seller for details

TCHP Polyclonal Antibody, HRP Conjugated

A61269 100 µg
EUR 570.55
Description: The best epigenetics products

TCHP Conjugated Antibody

C44773 100ul
EUR 397

anti- TCHP antibody

FNab08557 100µg
EUR 585
  • Immunogen: trichoplein, keratin filament binding
  • Uniprot ID: Q9BT92
  • Gene ID: 84260
  • Research Area: Cancer
Description: Antibody raised against TCHP

Anti-TCHP antibody

PAab08557 100 ug
EUR 412

Anti-TCHP antibody

STJ191797 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TCHP

TCHP siRNA

20-abx936354
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TCHP siRNA

20-abx936355
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TCHP Antibody, HRP conjugated

1-CSB-PA874804LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TCHP Antibody, FITC conjugated

1-CSB-PA874804LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TCHP Antibody, Biotin conjugated

1-CSB-PA874804LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TCHP Blocking Peptide

33R-4111 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCHP antibody, catalog no. 70R-10097

TCHP cloning plasmid

CSB-CL874804HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1497
  • Sequence: atggcgctcccgacgctgccgtcctactggtgcagccagcagcgcctgaatcagcagctagcacgacagcgagagcaggaggcccggcttcggcagcagtgggagcagaacagccgttacttcaggatgtctgacatctgcagctccaaacaggcagaatggagctctaaaacct
  • Show more
Description: A cloning plasmid for the TCHP gene.

TCHP Blocking Peptide

DF2457-BP 1mg
EUR 195

Mouse TCHP shRNA Plasmid

20-abx978836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TCHP shRNA Plasmid

20-abx963385
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TCHP ELISA KIT

ELI-23768h 96 Tests
EUR 824

TCHP Rabbit Polyclonal Antibody