TCHP Rabbit Polyclonal Antibody

TCHP Rabbit Polyclonal Antibody

TCHP Polyclonal Antibody
ES10639-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TCHP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TCHP antibody
70R-10097 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TCHP antibody

TCHP Antibody
44773-100ul 100ul
EUR 252

TCHP Antibody
44773-50ul 50ul
EUR 187

TCHP Antibody
1-CSB-PA874804LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500

TCHP Antibody
DF2457 200ul
EUR 304
Description: TCHP antibody detects endogenous levels of total TCHP.

TCHP Antibody
ABD13283 100 ug
EUR 438

TCHP Antibody
ABD2457 100 ug
EUR 438

TCHP Polyclonal Antibody, Biotin Conjugated
A61267 100 µg
EUR 570.55
Description: reagents widely cited

TCHP Polyclonal Antibody, FITC Conjugated
A61268 100 µg
EUR 570.55
Description: Ask the seller for details

TCHP Polyclonal Antibody, HRP Conjugated
A61269 100 µg
EUR 570.55
Description: The best epigenetics products

TCHP Conjugated Antibody
C44773 100ul
EUR 397

anti- TCHP antibody
FNab08557 100µg
EUR 585
  • Immunogen: trichoplein, keratin filament binding
  • Uniprot ID: Q9BT92
  • Gene ID: 84260
  • Research Area: Cancer
Description: Antibody raised against TCHP

Anti-TCHP antibody
PAab08557 100 ug
EUR 412

Anti-TCHP antibody
STJ191797 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TCHP

TCHP siRNA
20-abx936354
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TCHP siRNA
20-abx936355
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TCHP Antibody, HRP conjugated
1-CSB-PA874804LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TCHP Antibody, FITC conjugated
1-CSB-PA874804LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TCHP Antibody, Biotin conjugated
1-CSB-PA874804LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCHP. Recognizes TCHP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TCHP Blocking Peptide
33R-4111 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TCHP antibody, catalog no. 70R-10097

TCHP Blocking Peptide
DF2457-BP 1mg
EUR 195

TCHP cloning plasmid
CSB-CL874804HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1497
  • Sequence: atggcgctcccgacgctgccgtcctactggtgcagccagcagcgcctgaatcagcagctagcacgacagcgagagcaggaggcccggcttcggcagcagtgggagcagaacagccgttacttcaggatgtctgacatctgcagctccaaacaggcagaatggagctctaaaacct
  • Show more
Description: A cloning plasmid for the TCHP gene.

Human TCHP ELISA KIT
ELI-23768h 96 Tests
EUR 824

Mouse Tchp ELISA KIT
ELI-29182m 96 Tests
EUR 865

TCHP ELISA KIT|Human
EF003499 96 Tests
EUR 689

TCHP Rabbit Polyclonal Antibody