TSSC4 Rabbit Polyclonal Antibody

TSSC4 Rabbit Polyclonal Antibody

TSSC4 Antibody

ABD2487 100 ug
EUR 438

TSSC4 Antibody

44796-100ul 100ul
EUR 252

TSSC4 Antibody

44796-50ul 50ul
EUR 187

TSSC4 Antibody

DF2487 200ul
EUR 304
Description: TSSC4 antibody detects endogenous levels of total TSSC4.

Tssc4/ Rat Tssc4 ELISA Kit

ELI-28317r 96 Tests
EUR 886

TSSC4 Conjugated Antibody

C44796 100ul
EUR 397

anti- TSSC4 antibody

FNab09072 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200;IF: 1:10-1:100
  • Immunogen: tumor suppressing subtransferable candidate 4
  • Uniprot ID: Q9Y5U2
  • Gene ID: 10078
  • Research Area: Cancer
Description: Antibody raised against TSSC4

Human TSSC4 Antibody

32792-05111 150 ug
EUR 261

Anti-TSSC4 antibody

PAab09072 100 ug
EUR 412

Anti-TSSC4 antibody

STJ191831 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TSSC4

Bovine Protein TSSC4, TSSC4 ELISA KIT

ELI-45743b 96 Tests
EUR 928

Mouse Protein TSSC4, Tssc4 ELISA KIT

ELI-40054m 96 Tests
EUR 865

Human Protein TSSC4, TSSC4 ELISA KIT

ELI-51225h 96 Tests
EUR 824

TSSC4 siRNA

20-abx905843
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TSSC4 siRNA

20-abx938386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TSSC4 siRNA

20-abx938387
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TSSC4 Blocking Peptide

DF2487-BP 1mg
EUR 195

TSSC4 cloning plasmid

CSB-CL897299HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 798
  • Sequence: atggctgaggcaggaacaggcctcctcccagccacggtgcagccattccatctgagaggcatgagctccaccttctcccagcgcagccgtgacatctttgactgcctggagggggcggccagacgggctccatcctctgtggcccacaccagcatgagtgacaacggaggcttcaa
  • Show more
Description: A cloning plasmid for the TSSC4 gene.

TSSC4 cloning plasmid

CSB-CL897299HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaacacgggacggagtatgacacgctgccttccgacacagtctccctcagtgactcggactctgacctcagcttgcccggtggtgctgaagtggaagcactgtccccgatggggctgcctggggaggagga
  • Show more
Description: A cloning plasmid for the TSSC4 gene.

Human TSSC4 Antibody (Biotin Conjugate)

32792-05121 150 ug
EUR 369

Mouse TSSC4 shRNA Plasmid

20-abx974923
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TSSC4 shRNA Plasmid

20-abx990244
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TSSC4 ELISA KIT|Human

EF003913 96 Tests
EUR 689

Human TSSC4 shRNA Plasmid

20-abx956789
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TSSC4 protein (His tag)

80R-2112 100 ug
EUR 424
Description: Recombinant human TSSC4 protein (His tag)

TSSC4 Recombinant Protein (Human)

RP033238 100 ug Ask for price

TSSC4 Recombinant Protein (Human)

RP033241 100 ug Ask for price

TSSC4 Recombinant Protein (Rat)

RP235064 100 ug Ask for price

TSSC4 Recombinant Protein (Mouse)

RP181871 100 ug Ask for price

TSSC4 Recombinant Protein (Mouse)

RP181874 100 ug Ask for price

TSSC4 Recombinant Protein (Mouse)

RP181877 100 ug Ask for price

Human TSSC4 AssayLite Antibody (FITC Conjugate)

32792-05141 150 ug
EUR 428

Human TSSC4 AssayLite Antibody (RPE Conjugate)

32792-05151 150 ug
EUR 428

Human TSSC4 AssayLite Antibody (APC Conjugate)

32792-05161 150 ug
EUR 428

Human TSSC4 AssayLite Antibody (PerCP Conjugate)

32792-05171 150 ug
EUR 471

Tumor Suppressing Subtransferable Candidate 4 (TSSC4) Antibody

20-abx219508
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tumor Suppressing Subtransferable Candidate 4 (TSSC4) Antibody

abx239072-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Tssc4 ORF Vector (Rat) (pORF)

ORF078356 1.0 ug DNA
EUR 506

TSSC4 ORF Vector (Human) (pORF)

ORF011080 1.0 ug DNA
EUR 95

TSSC4 ORF Vector (Human) (pORF)

ORF011081 1.0 ug DNA
EUR 95

Tssc4 ORF Vector (Mouse) (pORF)

ORF060625 1.0 ug DNA
EUR 506

Tssc4 ORF Vector (Mouse) (pORF)

ORF060626 1.0 ug DNA
EUR 506

Tssc4 ORF Vector (Mouse) (pORF)

ORF060627 1.0 ug DNA
EUR 506

TSSC4 sgRNA CRISPR Lentivector set (Human)

K2545401 3 x 1.0 ug
EUR 339

Tssc4 sgRNA CRISPR Lentivector set (Mouse)

K4481601 3 x 1.0 ug
EUR 339

Tssc4 sgRNA CRISPR Lentivector set (Rat)

K6586601 3 x 1.0 ug
EUR 339

TSSC4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2545402 1.0 ug DNA
EUR 154

TSSC4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2545403 1.0 ug DNA
EUR 154

TSSC4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2545404 1.0 ug DNA
EUR 154

Tssc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4481602 1.0 ug DNA
EUR 154

Tssc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4481603 1.0 ug DNA
EUR 154

Tssc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4481604 1.0 ug DNA
EUR 154

Tssc4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6586602 1.0 ug DNA
EUR 154

Tssc4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6586603 1.0 ug DNA
EUR 154

Tssc4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6586604 1.0 ug DNA
EUR 154

TSSC4 Protein Vector (Human) (pPB-C-His)

PV044317 500 ng
EUR 329

TSSC4 Protein Vector (Human) (pPB-N-His)

PV044318 500 ng
EUR 329

TSSC4 Protein Vector (Human) (pPM-C-HA)

PV044319 500 ng
EUR 329

TSSC4 Protein Vector (Human) (pPM-C-His)

PV044320 500 ng
EUR 329

TSSC4 Protein Vector (Human) (pPB-C-His)

PV044321 500 ng
EUR 329

TSSC4 Rabbit Polyclonal Antibody