TSSK3 Rabbit Polyclonal Antibody

TSSK3 Rabbit Polyclonal Antibody

TSSK3 Rabbit pAb

A7605-100ul 100 ul
EUR 308

TSSK3 Rabbit pAb

A7605-200ul 200 ul
EUR 459

TSSK3 Rabbit pAb

A7605-20ul 20 ul
EUR 183

TSSK3 Rabbit pAb

A7605-50ul 50 ul
EUR 223

TSSK3 Antibody

47228-100ul 100ul
EUR 252

TSSK3 Antibody

44894-100ul 100ul
EUR 252

TSSK3 Antibody

44894-50ul 50ul
EUR 187

TSSK3 Antibody

1-CSB-PA850410ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TSSK3. Recognizes TSSK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TSSK3 Antibody

DF2686 200ul
EUR 304
Description: TSSK3 antibody detects endogenous levels of total TSSK3.

TSSK3 Antibody

ABD2686 100 ug
EUR 438

TSSK3 Conjugated Antibody

C44894 100ul
EUR 397

TSSK3 Conjugated Antibody

C47228 100ul
EUR 397

Anti-TSSK3 antibody

STJ29742 100 µl
EUR 277
Description: This gene encodes a kinase expressed exclusively in the testis that is thought to play a role in either germ cell differentiation or mature sperm function.

Anti-TSSK3 antibody

STJ191994 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TSSK3

TSSK3 siRNA

20-abx938392
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TSSK3 siRNA

20-abx938393
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TSSK3 Blocking Peptide

DF2686-BP 1mg
EUR 195

TSSK3 cloning plasmid

CSB-CL850410HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 807
  • Sequence: atggaggactttctgctctccaatgggtaccagctgggcaagaccattggggaagggacctactcaaaagtcaaagaagcattttccaaaaaacaccaaagaaaagtggcaattaaagttatagacaagatgggagggccagaagagtttatccagagattcctccctcgggagct
  • Show more
Description: A cloning plasmid for the TSSK3 gene.

anti-TSSK3 (3G8)

LF-MA10347 100 ug
EUR 363
Description: Mouse monoclonal to TSSK3

pDONR223-TSSK3 Plasmid

PVTB00936 2 ug
EUR 356

Mouse TSSK3 shRNA Plasmid

20-abx975115
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TSSK3 shRNA Plasmid

20-abx963035
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Tssk3 ELISA KIT

ELI-40055m 96 Tests
EUR 865

Human TSSK3 ELISA KIT

ELI-40374h 96 Tests
EUR 824

TSSK3 Recombinant Protein (Rat)

RP235073 100 ug Ask for price

TSSK3 Recombinant Protein (Human)

RP033247 100 ug Ask for price

TSSK3 Recombinant Protein (Mouse)

RP181886 100 ug Ask for price

Tssk3 ORF Vector (Rat) (pORF)

ORF078359 1.0 ug DNA
EUR 506

h TSSK3 inducible lentiviral particles

LVP245 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TSSK3, is fully sequence verified and matched to NCBI accession ID: NM_052841

TSSK3 ORF Vector (Human) (pORF)

ORF011083 1.0 ug DNA
EUR 95

Tssk3 ORF Vector (Mouse) (pORF)

ORF060630 1.0 ug DNA
EUR 506

Tssk3 sgRNA CRISPR Lentivector set (Rat)

K6365001 3 x 1.0 ug
EUR 339

TSSK3 sgRNA CRISPR Lentivector set (Human)

K2545801 3 x 1.0 ug
EUR 339

Tssk3 sgRNA CRISPR Lentivector set (Mouse)

K3481901 3 x 1.0 ug
EUR 339

Testis-Specific Serine/threonine-Protein Kinase 3 (TSSK3) Antibody

20-abx006028
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Testis-Specific Serine/threonine-Protein Kinase 3 (TSSK3) Antibody

20-abx147614
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Testis-Specific Serine/threonine-Protein Kinase 3 (TSSK3) Antibody

abx340164-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Testis-Specific Serine/threonine-Protein Kinase 3 (TSSK3) Antibody

20-abx320980
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tssk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6365002 1.0 ug DNA
EUR 154

Tssk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6365003 1.0 ug DNA
EUR 154

Tssk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6365004 1.0 ug DNA
EUR 154

TSSK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2545802 1.0 ug DNA
EUR 154

TSSK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2545803 1.0 ug DNA
EUR 154

TSSK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2545804 1.0 ug DNA
EUR 154

Tssk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3481902 1.0 ug DNA
EUR 154

Tssk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3481903 1.0 ug DNA
EUR 154

Tssk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3481904 1.0 ug DNA
EUR 154

TSSK3 Protein Vector (Mouse) (pPB-C-His)

PV242518 500 ng
EUR 603

TSSK3 Protein Vector (Mouse) (pPB-N-His)

PV242519 500 ng
EUR 603

TSSK3 Protein Vector (Mouse) (pPM-C-HA)

PV242520 500 ng
EUR 603

TSSK3 Protein Vector (Mouse) (pPM-C-His)

PV242521 500 ng
EUR 603

TSSK3 Protein Vector (Rat) (pPB-C-His)

PV313434 500 ng
EUR 603

TSSK3 Protein Vector (Rat) (pPB-N-His)

PV313435 500 ng
EUR 603

TSSK3 Protein Vector (Rat) (pPM-C-HA)

PV313436 500 ng
EUR 603

TSSK3 Protein Vector (Rat) (pPM-C-His)

PV313437 500 ng
EUR 603

TSSK3 Protein Vector (Human) (pPB-C-His)

PV044329 500 ng
EUR 329

TSSK3 Protein Vector (Human) (pPB-N-His)

PV044330 500 ng
EUR 329

TSSK3 Protein Vector (Human) (pPM-C-HA)

PV044331 500 ng
EUR 329

TSSK3 Protein Vector (Human) (pPM-C-His)

PV044332 500 ng
EUR 329

Recombinant Human TSSK3 Protein, GST, E.coli-100ug

QP7965-ec-100ug 100ug
EUR 571

Recombinant Human TSSK3 Protein, GST, E.coli-10ug

QP7965-ec-10ug 10ug
EUR 272

Recombinant Human TSSK3 Protein, GST, E.coli-1mg

QP7965-ec-1mg 1mg
EUR 2303

Recombinant Human TSSK3 Protein, GST, E.coli-200ug

QP7965-ec-200ug 200ug
EUR 898

Recombinant Human TSSK3 Protein, GST, E.coli-500ug

QP7965-ec-500ug 500ug
EUR 1514

Recombinant Human TSSK3 Protein, GST, E.coli-50ug

QP7965-ec-50ug 50ug
EUR 362

Tssk3 3'UTR Luciferase Stable Cell Line

TU121269 1.0 ml Ask for price

TSSK3 3'UTR GFP Stable Cell Line

TU077373 1.0 ml
EUR 1394

Tssk3 3'UTR GFP Stable Cell Line

TU171269 1.0 ml Ask for price

Tssk3 3'UTR Luciferase Stable Cell Line

TU222580 1.0 ml Ask for price

TSSK3 3'UTR Luciferase Stable Cell Line

TU027373 1.0 ml
EUR 1394

Tssk3 3'UTR GFP Stable Cell Line

TU272580 1.0 ml Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

TSSK3 Rabbit Polyclonal Antibody