UBA6 Rabbit Polyclonal Antibody
UBA6 Polyclonal Antibody |
ABP60817-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UBA6 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBA6 from Human, Mouse. This UBA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBA6 protein |
UBA6 Polyclonal Antibody |
ES10429-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against UBA6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UBA6 Polyclonal Antibody |
ES10429-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against UBA6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UBA6 Rabbit pAb |
A7511-100ul |
Abclonal |
100 ul |
EUR 308 |
UBA6 Rabbit pAb |
A7511-200ul |
Abclonal |
200 ul |
EUR 459 |
UBA6 Rabbit pAb |
A7511-20ul |
Abclonal |
20 ul |
EUR 183 |
UBA6 Rabbit pAb |
A7511-50ul |
Abclonal |
50 ul |
EUR 223 |
UBA6 Rabbit pAb |
A4819-100ul |
Abclonal |
100 ul |
EUR 308 |
UBA6 Rabbit pAb |
A4819-200ul |
Abclonal |
200 ul |
EUR 459 |
UBA6 Rabbit pAb |
A4819-20ul |
Abclonal |
20 ul |
Ask for price |
UBA6 Rabbit pAb |
A4819-50ul |
Abclonal |
50 ul |
Ask for price |
UBA6 antibody |
70R-21088 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBA6 antibody |
UBA6 Antibody |
43598-100ul |
SAB |
100ul |
EUR 252 |
UBA6 antibody |
70R-9758 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal UBA6 antibody |
UBA6 Antibody |
1-CSB-PA025420ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
UBA6 Antibody |
1-CSB-PA025420ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
UBA6 Antibody |
1-CSB-PA025420GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
UBA6 Antibody |
1-CSB-PA025420LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal UBA6 Antibody (C-term) |
APR04152G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBA6 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal UBA6 Antibody (C-term) |
APR06963G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBA6 (C-term). This antibody is tested and proven to work in the following applications: |
UBA6 Conjugated Antibody |
C43598 |
SAB |
100ul |
EUR 397 |
anti- UBA6 antibody |
FNab09146 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: ubiquitin-like modifier activating enzyme 6
- Uniprot ID: A0AVT1
- Gene ID: 55236
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against UBA6 |
Anti-UBA6 antibody |
STJ191587 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UBA6 |
UBA6 siRNA |
20-abx938725 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBA6 siRNA |
20-abx938726 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBA6 Antibody, HRP conjugated |
1-CSB-PA025420LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UBA6 Antibody, FITC conjugated |
1-CSB-PA025420LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UBA6 Antibody, Biotin conjugated |
1-CSB-PA025420LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
UBA6 Blocking Peptide |
33R-2792 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBA6 antibody, catalog no. 70R-9758 |
UBA6 cloning plasmid |
CSB-CL025420HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1170
- Sequence: atggaaggatccgagcctgtggccgcccatcagggggaagaggcgtcctgttcttcctgggggactggcagcacaaataaaaatttgcccattatgtcaacagcatctgtggaaatcgatgatgcattgtatagtcgacagaggtacgttcttggagacacagcaatgcagaaga
- Show more
|
Description: A cloning plasmid for the UBA6 gene. |
UBA6 cloning plasmid |
CSB-CL025420HU2-10ug |
Cusabio |
10ug |
EUR 1130 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3159
- Sequence: atggaaggatccgagcctgtggccgcccatcagggggaagaggcgtcctgttcttcctgggggactggcagcacaaataaaaatttgcccattatgtcaacagcatctgtggaaatcgatgatgcattgtatagtcgacagaggtacgttcttggagacacagcaatgcagaaga
- Show more
|
Description: A cloning plasmid for the UBA6 gene. |
Human UBA6 shRNA Plasmid |
20-abx960582 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse UBA6 shRNA Plasmid |
20-abx981872 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Uba6 ORF Vector (Rat) (pORF) |
ORF078496 |
ABM |
1.0 ug DNA |
EUR 506 |
UBA6 Rabbit Polyclonal Antibody