UBE2K Rabbit Polyclonal Antibody

UBE2K Rabbit Polyclonal Antibody

UBE2K Polyclonal Antibody

ABP60821-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2K protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2K from Human, Mouse. This UBE2K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2K protein

UBE2K Polyclonal Antibody

A-8703 100 µl
EUR 724.25
Description: Ask the seller for details

UBE2K Polyclonal Antibody

A57858 100 µg
EUR 570.55
Description: fast delivery possible

UBE2K Polyclonal Antibody

A53456 100 µg
EUR 570.55
Description: The best epigenetics products

UBE2K Rabbit pAb

A0655-100ul 100 ul
EUR 308

UBE2K Rabbit pAb

A0655-200ul 200 ul
EUR 459

UBE2K Rabbit pAb

A0655-20ul 20 ul Ask for price

UBE2K Rabbit pAb

A0655-50ul 50 ul Ask for price

UBE2K Rabbit pAb

A1086-100ul 100 ul
EUR 308

UBE2K Rabbit pAb

A1086-200ul 200 ul
EUR 459

UBE2K Rabbit pAb

A1086-20ul 20 ul
EUR 183

UBE2K Rabbit pAb

A1086-50ul 50 ul
EUR 223

UBE2K antibody

70R-21107 50 ul
EUR 435
Description: Rabbit polyclonal UBE2K antibody

UBE2K antibody

70R-2724 50 ug
EUR 467
Description: Rabbit polyclonal UBE2K antibody

UBE2K antibody

70R-9579 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UBE2K antibody

UBE2K antibody

70R-9580 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UBE2K antibody

UBE2K Antibody

ABD6231 100 ug
EUR 438

UBE2K antibody

38184-100ul 100ul
EUR 252

UBE2K Antibody

DF6231 200ul
EUR 304
Description: UBE2K Antibody detects endogenous levels of total UBE2K.

UBE2K Antibody

1-CSB-PA09667A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500

UBE2K Antibody

1-CSB-PA09669A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UBE2K Antibody

1-CSB-PA025460GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal UBE2K Antibody(N-term)

APR13900G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2K (N-term). This antibody is tested and proven to work in the following applications:

UBE2K Polyclonal Antibody, Biotin Conjugated

A53453 100 µg
EUR 570.55
Description: Ask the seller for details

UBE2K Polyclonal Antibody, FITC Conjugated

A53454 100 µg
EUR 570.55
Description: The best epigenetics products

UBE2K Polyclonal Antibody, HRP Conjugated

A53455 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal UBE2K / LIG Antibody (C-Terminus)

APR13899G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBE2K / LIG (C-Terminus). This antibody is tested and proven to work in the following applications:

UBE2K Conjugated Antibody

C38184 100ul
EUR 397

anti- UBE2K antibody

FNab09178 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin-conjugating enzyme E2K
  • Uniprot ID: P61086
  • Gene ID: 3093
  • Research Area: Neuroscience, Immunology, Metabolism, Epigenetics
Description: Antibody raised against UBE2K

Anti-UBE2K antibody

PAab09178 100 ug
EUR 386

Anti-UBE2K antibody

STJ26018 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene.

Anti-UBE2K antibody

STJ26019 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene.

Anti-UBE2K antibody

STJ191605 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2K

UBE2K siRNA

20-abx938788
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2K siRNA

20-abx938789
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBE2K Antibody, HRP conjugated

1-CSB-PA09667B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBE2K Antibody, FITC conjugated

1-CSB-PA09667C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBE2K Antibody, Biotin conjugated

1-CSB-PA09667D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UBE2K Antibody, HRP conjugated

1-CSB-PA09669B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBE2K Antibody, FITC conjugated

1-CSB-PA09669C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBE2K Antibody, Biotin conjugated

1-CSB-PA09669D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UBE2K cloning plasmid

CSB-CL025460HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 603
  • Sequence: atggccaacatcgcggtgcagcgaatcaagcgggagttcaaggaggtgctgaagagcgaggagacgagcaaaaatcaaattaaagtagatcttgtagatgagaattttacagaattaagaggagaaatagcaggacctccagacacaccatatgaaggaggaagataccaactaga
  • Show more
Description: A cloning plasmid for the UBE2K gene.

UBE2K Blocking Peptide

33R-3087 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-9579

UBE2K Blocking Peptide

33R-7744 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-2724

UBE2K Blocking Peptide

33R-9361 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-9580

UBE2K Blocking Peptide

DF6231-BP 1mg
EUR 195

Mouse UBE2K shRNA Plasmid

20-abx974319
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBE2K ELISA KIT|Human

EF004006 96 Tests
EUR 689

UBE2K protein (His tag)

80R-1652 50 ug
EUR 397
Description: Purified recombinant Human UBE2K protein

Human UBE2K shRNA Plasmid

20-abx952107
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBE2K Recombinant Protein (Human)

RP033718 100 ug Ask for price

UBE2K Recombinant Protein (Rat)

RP235568 100 ug Ask for price

UBE2K Recombinant Protein (Mouse)

RP182687 100 ug Ask for price

Ubiquitin-Conjugating Enzyme E2 K (UBE2K) Antibody

20-abx116471
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 K (UBE2K) Antibody

20-abx110330
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 K (UBE2K) Antibody

20-abx110331
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 K (UBE2K) Antibody

20-abx000798
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 K (UBE2K) Antibody

20-abx001009
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 K (UBE2K) Antibody

abx031220-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 K (UBE2K) Antibody

abx031220-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UBE2K Rabbit Polyclonal Antibody