UBE2O Rabbit Polyclonal Antibody

UBE2O Rabbit Polyclonal Antibody

UBE2O Polyclonal Antibody

ABP60822-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2O protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2O from Human, Mouse. This UBE2O antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2O protein

UBE2O Polyclonal Antibody

ES10440-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UBE2O from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

UBE2O Polyclonal Antibody

ES10440-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBE2O from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

UBE2O Rabbit pAb

A17201-100ul 100 ul
EUR 308

UBE2O Rabbit pAb

A17201-200ul 200 ul
EUR 459

UBE2O Rabbit pAb

A17201-20ul 20 ul
EUR 183

UBE2O Rabbit pAb

A17201-50ul 50 ul
EUR 223

UBE2O Polyclonal Conjugated Antibody

C27266 100ul
EUR 397

UBE2O Polyclonal Conjugated Antibody

C29994 100ul
EUR 397

UBE2O antibody

70R-21111 50 ul
EUR 435
Description: Rabbit polyclonal UBE2O antibody

UBE2O Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

UBE2O antibody

70R-3984 50 ug
EUR 467
Description: Rabbit polyclonal UBE2O antibody raised against the middle region of UBE2O

UBE2O Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

[KO Validated] UBE2O Polyclonal Antibody

27266-100ul 100ul
EUR 252

[KO Validated] UBE2O Polyclonal Antibody

27266-50ul 50ul
EUR 187

Polyclonal UBE2O antibody - middle region

APR01365G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2O - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal UBE2O Antibody (C-Terminus)

APG01143G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBE2O (C-Terminus). This antibody is tested and proven to work in the following applications:

UBE2O Polyclonal Antibody, Biotin Conjugated

A61635 100 µg
EUR 570.55
Description: fast delivery possible

UBE2O Polyclonal Antibody, FITC Conjugated

A61636 100 µg
EUR 570.55
Description: reagents widely cited

UBE2O Polyclonal Antibody, HRP Conjugated

A61637 100 µg
EUR 570.55
Description: Ask the seller for details

[KO Validated] UBE2O Rabbit pAb

A10036-100ul 100 ul
EUR 410

[KO Validated] UBE2O Rabbit pAb

A10036-200ul 200 ul
EUR 571

[KO Validated] UBE2O Rabbit pAb

A10036-20ul 20 ul
EUR 221

[KO Validated] UBE2O Rabbit pAb

A10036-50ul 50 ul
EUR 287

anti- UBE2O antibody

FNab09181 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: ubiquitin-conjugating enzyme E2O
  • Uniprot ID: Q9C0C9
  • Gene ID: 63893
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2O

Anti-UBE2O antibody

PAab09181 100 ug
EUR 412

Anti-UBE2O antibody

STJ112076 100 µl
EUR 413

Anti-UBE2O antibody

STJ119392 100 µl
EUR 277

Anti-UBE2O antibody

STJ191598 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2O


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA20403 100 ug
EUR 403
Description: Rabbit polyclonal to UBE2O

Polyclonal E2-230K / UBE2O Antibody (C-Term)

APG00392G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human E2-230K / UBE2O (C-Term). This antibody is tested and proven to work in the following applications:

UBE2O Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBE2O Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBE2O Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UBE2O Blocking Peptide

33R-10192 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2O antibody, catalog no. 70R-3984

UBE2O cloning plasmid

CSB-CL866339HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1401
  • Sequence: atgactgtggagcagctgctgacgggctcgcccacctctccgactgtggagcctgagaagccaactcgggagaagaagtttctggatgacatcaagaagctacaggaaaacctcaagaagaccctggacaatgtggccattgtagaggaggagaagatggaagcagtgcccgacg
  • Show more
Description: A cloning plasmid for the UBE2O gene.

UBE2O cloning plasmid

CSB-CL866339HU2-10ug 10ug
EUR 733
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2226
  • Sequence: atgacctcagccgacgtgatgtggcaggatggctccgtggaatgcaacatccgctccaacgacctcttccctgtgcaccacctggacaacaacgagttctgccctggagacttcgtggtagataagcgagtccagagctgtccagaccctgctgtctacggtgtggtacagtctg
  • Show more
Description: A cloning plasmid for the UBE2O gene.

Anti-UBE2O (2C10)

YF-MA19174 100 ug
EUR 363
Description: Mouse monoclonal to UBE2O

Anti-E2-230K / UBE2O antibody

STJ70296 100 µg
EUR 359


EF004009 96 Tests
EUR 689

Mouse UBE2O shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human UBE2O shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT14245 2 ug
EUR 599

Ubiquitin-Conjugating Enzyme E2O (UBE2O) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 O (UBE2O) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 O (UBE2O) Antibody

abx239181-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ubiquitin-Conjugating Enzyme E2 O (UBE2O) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UBE2O ORF Vector (Human) (pORF)

ORF011243 1.0 ug DNA
EUR 95

UBE2O ORF Vector (Human) (pORF)

ORF011244 1.0 ug DNA
EUR 95

Ube2o ORF Vector (Mouse) (pORF)

ORF060904 1.0 ug DNA
EUR 506


PVT13525 2 ug
EUR 391

UBE2O Rabbit Polyclonal Antibody