UBE2S Rabbit Polyclonal Antibody
 UBE2S Rabbit pAb |
|
A4658-100ul |
Abclonal |
100 ul |
EUR 308 |
UBE2S Rabbit pAb |
|
A4658-200ul |
Abclonal |
200 ul |
EUR 459 |
UBE2S Rabbit pAb |
|
A4658-20ul |
Abclonal |
20 ul |
EUR 183 |
UBE2S Rabbit pAb |
|
A4658-50ul |
Abclonal |
50 ul |
EUR 223 |
 UBE2S Polyclonal Conjugated Antibody |
|
C30283 |
SAB |
100ul |
EUR 397 |
 UBE2S antibody |
|
70R-21113 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal UBE2S antibody |
UBE2S antibody |
|
70R-2798 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal UBE2S antibody raised against the N terminal of UBE2S |
 UBE2S Antibody |
|
36429-100ul |
SAB |
100ul |
EUR 252 |
UBE2S antibody |
|
10R-1162 |
Fitzgerald |
100 ul |
EUR 316 |
|
Description: Mouse monoclonal UBE2S antibody |
UBE2S Antibody |
|
1-CSB-PA142614 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200 |
UBE2S Antibody |
|
1-CSB-PA623095DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
UBE2S Antibody |
|
1-CSB-PA245297 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
UBE2S Antibody |
|
1-CSB-PA025477GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against UBE2S. Recognizes UBE2S from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 [KO Validated] UBE2S Polyclonal Antibody |
|
30283-100ul |
SAB |
100ul |
EUR 252 |
[KO Validated] UBE2S Polyclonal Antibody |
|
30283-50ul |
SAB |
50ul |
EUR 187 |
 [KO Validated] UBE2S Rabbit pAb |
|
A18064-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] UBE2S Rabbit pAb |
|
A18064-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] UBE2S Rabbit pAb |
|
A18064-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] UBE2S Rabbit pAb |
|
A18064-50ul |
Abclonal |
50 ul |
EUR 287 |
 UBE2S Conjugated Antibody |
|
C36429 |
SAB |
100ul |
EUR 397 |
 anti- UBE2S antibody |
|
FNab09183 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: ubiquitin-conjugating enzyme E2S
- Uniprot ID: Q16763
- Gene ID: 27338
- Research Area: Epigenetics, Metabolism
|
|
Description: Antibody raised against UBE2S |
 Anti-UBE2S antibody |
|
STJ11100037 |
St John's Laboratory |
100 µl |
EUR 413 |
|
Description: This gene encodes a member of the ubiquitin-conjugating enzyme family. The encoded protein is able to form a thiol ester linkage with ubiquitin in a ubiquitin activating enzyme-dependent manner, a characteristic property of ubiquitin carrier proteins. |
Anti-UBE2S antibody |
|
STJ26022 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the ubiquitin-conjugating enzyme family. The encoded protein is able to form a thiol ester linkage with ubiquitin in a ubiquitin activating enzyme-dependent manner, a characteristic property of ubiquitin carrier proteins. |
Anti-UBE2S antibody |
|
STJ191602 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to UBE2S |
 UBE2S siRNA |
|
20-abx905912 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2S siRNA |
|
20-abx938810 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2S siRNA |
|
20-abx938811 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human)) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human) |
|
4-PAE661Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S) |
 UBE2S Blocking Peptide |
|
33R-6884 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2S antibody, catalog no. 70R-2798 |
 UBE2S cloning plasmid |
|
CSB-CL623095HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 669
- Sequence: atgaactccaacgtggagaacctacccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaggggaccccatatgctggaggtct
- Show more
|
|
Description: A cloning plasmid for the UBE2S gene. |
UBE2S cloning plasmid |
|
CSB-CL623095HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 669
- Sequence: atgaactccaacgtggagaacctgcccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaagggaccccatatgctggaggtct
- Show more
|
|
Description: A cloning plasmid for the UBE2S gene. |
UBE2S cloning plasmid |
|
CSB-CL623095HU3-10ug |
Cusabio |
10ug |
EUR 297 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 669
- Sequence: atgaactccaacgtggagaacctacccccgcacatcatccgcctggtgtacaaggaggtgacgacactgaccgcagacccacccgatggcatcaaggtctttcccaacgaggaggacctcaccgacctccaggtcaccatcgagggccctgaggggaccccatatgctggaggtct
- Show more
|
|
Description: A cloning plasmid for the UBE2S gene. |
 Polyclonal Antibody (Human), APC) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), APC |
|
4-PAE661Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), Biotinylated |
|
4-PAE661Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), Cy3 |
|
4-PAE661Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), FITC |
|
4-PAE661Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), HRP |
|
4-PAE661Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), PE |
|
4-PAE661Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with PE. |
 Antibody) Ubiquitin Conjugating Enzyme E2S (UBE2S) Antibody |
|
20-abx178800 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Antibody) Ubiquitin-Conjugating Enzyme E2S (UBE2S) Antibody |
|
20-abx116477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin Conjugating Enzyme E2S (UBE2S) Antibody |
|
20-abx132206 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ubiquitin Conjugating Enzyme E2S (UBE2S) Antibody |
|
20-abx137303 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Ubiquitin Conjugating Enzyme E2S (UBE2S) Antibody |
|
20-abx241616 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin Conjugating Enzyme E2S (UBE2S) Antibody |
|
20-abx241770 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) UBE2S protein (His tag) |
|
80R-1188 |
Fitzgerald |
100 ug |
EUR 224 |
|
Description: Purified recombinant Human UBE2S protein |
 Rat UBE2S shRNA Plasmid |
|
20-abx988566 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse UBE2S shRNA Plasmid |
|
20-abx978841 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human UBE2S shRNA Plasmid |
|
20-abx959087 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) UBE2S Recombinant Protein (Rat) |
|
RP235592 |
ABM |
100 ug |
Ask for price |
) UBE2S Recombinant Protein (Human) |
|
RP033745 |
ABM |
100 ug |
Ask for price |
UBE2S Recombinant Protein (Human) |
|
RP033748 |
ABM |
100 ug |
Ask for price |
UBE2S Recombinant Protein (Human) |
|
RP033751 |
ABM |
100 ug |
Ask for price |
) UBE2S Recombinant Protein (Mouse) |
|
RP182723 |
ABM |
100 ug |
Ask for price |
 Polyclonal Antibody (Human), APC-Cy7) Ubiquitin Conjugating Enzyme E2S (UBE2S) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAE661Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Met1~Ala209
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ubiquitin Conjugating Enzyme E2S (UBE2S). This antibody is labeled with APC-Cy7. |
 Antibody) Ubiquitin-Conjugating Enzyme E2 S (UBE2S) Antibody |
|
20-abx003511 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 S (UBE2S) Antibody |
|
abx031369-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 S (UBE2S) Antibody |
|
abx031369-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 S (UBE2S) Antibody |
|
abx239183-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Ubiquitin-Conjugating Enzyme E2 S (UBE2S) Antibody |
|
20-abx321308 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) Ube2s ORF Vector (Rat) (pORF) |
|
ORF078532 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) UBE2S ORF Vector (Human) (pORF) |
|
ORF011249 |
ABM |
1.0 ug DNA |
EUR 95 |
UBE2S ORF Vector (Human) (pORF) |
|
ORF011250 |
ABM |
1.0 ug DNA |
EUR 95 |
UBE2S ORF Vector (Human) (pORF) |
|
ORF011251 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Ube2s ORF Vector (Mouse) (pORF) |
|
ORF060909 |
ABM |
1.0 ug DNA |
EUR 506 |
) Ube2s sgRNA CRISPR Lentivector set (Rat) |
|
K6234401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) UBE2S sgRNA CRISPR Lentivector set (Human) |
|
K2574301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ube2s sgRNA CRISPR Lentivector set (Mouse) |
|
K4097901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Recombinant Ubiquitin Conjugating Enzyme E2S (UBE2S) |
|
4-RPE661Hu01 |
Cloud-Clone |
-
EUR 189.60
-
EUR 154.00
-
EUR 436.00
-
EUR 212.00
-
EUR 324.00
-
EUR 190.00
-
EUR 940.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16763
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.9kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Ubiquitin Conjugating Enzyme E2S expressed in: E.coli |
Recombinant Ubiquitin Conjugating Enzyme E2S (UBE2S) |
|
4-RPE661Mu01 |
Cloud-Clone |
-
EUR 216.48
-
EUR 161.00
-
EUR 536.80
-
EUR 245.60
-
EUR 391.20
-
EUR 208.00
-
EUR 1192.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q921J4
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.9kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Mouse Ubiquitin Conjugating Enzyme E2S expressed in: E.coli |
) Human Ubiquitin-conjugating enzyme E2 S (UBE2S) |
|
1-CSB-EP623095HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Ubiquitin-conjugating enzyme E2 S(UBE2S) expressed in E.coli |
 Protein) Human Ubiquitin Conjugating Enzyme E2S (UBE2S) Protein |
|
20-abx650611 |
Abbexa |
-
EUR 272.00
-
EUR 189.00
-
EUR 606.00
-
EUR 300.00
-
EUR 230.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Protein) Mouse Ubiquitin Conjugating Enzyme E2S (UBE2S) Protein |
|
20-abx650612 |
Abbexa |
-
EUR 300.00
-
EUR 203.00
-
EUR 746.00
-
EUR 342.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (Target 1)) Ube2s sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6234402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ube2s sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6234403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ube2s sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6234404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) UBE2S sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2574302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) UBE2S sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2574303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) UBE2S sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2574304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ube2s sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4097902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ube2s sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4097903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ube2s sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4097904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) UBE2S Protein Vector (Mouse) (pPB-C-His) |
|
PV243634 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) UBE2S Protein Vector (Mouse) (pPB-N-His) |
|
PV243635 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) UBE2S Protein Vector (Mouse) (pPM-C-HA) |
|
PV243636 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) UBE2S Protein Vector (Mouse) (pPM-C-His) |
|
PV243637 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) UBE2S Protein Vector (Rat) (pPB-C-His) |
|
PV314126 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) UBE2S Protein Vector (Rat) (pPB-N-His) |
|
PV314127 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) UBE2S Protein Vector (Rat) (pPM-C-HA) |
|
PV314128 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) UBE2S Protein Vector (Rat) (pPM-C-His) |
|
PV314129 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) UBE2S Protein Vector (Human) (pPB-C-His) |
|
PV044993 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) UBE2S Protein Vector (Human) (pPB-N-His) |
|
PV044994 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) UBE2S Protein Vector (Human) (pPM-C-HA) |
|
PV044995 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) UBE2S Protein Vector (Human) (pPM-C-His) |
|
PV044996 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPB-C-His) |
|
PV044997 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPB-N-His) |
|
PV044998 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPM-C-HA) |
|
PV044999 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPM-C-His) |
|
PV045000 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPB-C-His) |
|
PV045001 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPB-N-His) |
|
PV045002 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPM-C-HA) |
|
PV045003 |
ABM |
500 ng |
EUR 329 |
UBE2S Protein Vector (Human) (pPM-C-His) |
|
PV045004 |
ABM |
500 ng |
EUR 329 |
 Ube2s 3'UTR Luciferase Stable Cell Line |
|
TU121475 |
ABM |
1.0 ml |
Ask for price |
 UBE2S 3'UTR GFP Stable Cell Line |
|
TU077686 |
ABM |
1.0 ml |
EUR 1394 |
 Ube2s 3'UTR GFP Stable Cell Line |
|
TU171475 |
ABM |
1.0 ml |
Ask for price |
Ube2s 3'UTR Luciferase Stable Cell Line |
|
TU222764 |
ABM |
1.0 ml |
Ask for price |
 UBE2S 3'UTR Luciferase Stable Cell Line |
|
TU027686 |
ABM |
1.0 ml |
EUR 1394 |
Ube2s 3'UTR GFP Stable Cell Line |
|
TU272764 |
ABM |
1.0 ml |
Ask for price |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
 MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
 MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
 Nrf2 Rabbit Polyclonal Antibody |
|
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
|
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
|
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
 ATG4a Rabbit Polyclonal Antibody |
|
ABP57576-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
|
ABP57576-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
|
ABP57576-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
 ATG4b Rabbit Polyclonal Antibody |
|
ABP57577-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
|
ABP57577-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
|
ABP57577-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
 ATG4c Rabbit Polyclonal Antibody |
|
ABP57578-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
|
ABP57578-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
|
ABP57578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
UBE2S Rabbit Polyclonal Antibody
