UBE2U Rabbit Polyclonal Antibody

UBE2U Rabbit Polyclonal Antibody

UBE2U Polyclonal Antibody

ABP60824-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UBE2U protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2U from Human. This UBE2U antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2U protein

UBE2U Polyclonal Antibody

ABP60824-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBE2U protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2U from Human. This UBE2U antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2U protein

UBE2U Polyclonal Antibody

ABP60824-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2U protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2U from Human. This UBE2U antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2U protein

UBE2U Rabbit pAb

A8376-100ul 100 ul
EUR 308

UBE2U Rabbit pAb

A8376-200ul 200 ul
EUR 459

UBE2U Rabbit pAb

A8376-20ul 20 ul
EUR 183

UBE2U Rabbit pAb

A8376-50ul 50 ul
EUR 223

UBE2U antibody

70R-21115 50 ul
EUR 435
Description: Rabbit polyclonal UBE2U antibody

UBE2U Antibody

ABD10002 100 ug
EUR 438

UBE2U Antibody

43389-100ul 100ul
EUR 252

UBE2U Antibody

DF10002 200ul
EUR 304
Description: UBE2U Antibody detects endogenous levels of total UBE2U.

UBE2U Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2U. Recognizes UBE2U from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

UBE2U Conjugated Antibody

C43389 100ul
EUR 397

anti- UBE2U antibody

FNab09186 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ubiquitin-conjugating enzyme E2U (putative)
  • Uniprot ID: Q5VVX9
  • Gene ID: 148581
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2U

Anti-UBE2U antibody

PAab09186 100 ug
EUR 412

Anti-UBE2U antibody

STJ110674 100 µl
EUR 277

Anti-UBE2U antibody

STJ191603 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2U


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT11499 2 ug
EUR 273


YF-PA22429 50 ul
EUR 363
Description: Mouse polyclonal to UBE2U


YF-PA26912 50 ul
EUR 334
Description: Mouse polyclonal to UBE2U

UBE2U Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

UBE2U Blocking Peptide

DF10002-BP 1mg
EUR 195

UBE2U cloning plasmid

CSB-CL716578HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atgcacggcagagcttacctcttgctgcacagagacttctgtgatctcaaggagaacaattataagggtatcactgctaagcctgtaagtgaagatatgatggaatgggaagttgaaattgaaggtctacagaattcagtttggcagggtttagtcttccaactgacaatacattt
  • Show more
Description: A cloning plasmid for the UBE2U gene.

Anti-UBE2U (3D4)

YF-MA19919 100 ug
EUR 363
Description: Mouse monoclonal to UBE2U

Human UBE2U shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004014 96 Tests
EUR 689

UBE2U Recombinant Protein (Human)

RP033757 100 ug Ask for price

UBE2U Recombinant Protein (Mouse)

RP182729 100 ug Ask for price


PVT13365 2 ug
EUR 599

Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody

abx028990-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody

abx028990-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody

abx239186-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

UBE2U ORF Vector (Human) (pORF)

ORF011253 1.0 ug DNA
EUR 95

Ube2u ORF Vector (Mouse) (pORF)

ORF060911 1.0 ug DNA
EUR 506

UBE2U sgRNA CRISPR Lentivector set (Human)

K2574701 3 x 1.0 ug
EUR 339

Ube2u sgRNA CRISPR Lentivector set (Mouse)

K3304001 3 x 1.0 ug
EUR 339

UBE2U sgRNA CRISPR Lentivector (Human) (Target 1)

K2574702 1.0 ug DNA
EUR 154

UBE2U sgRNA CRISPR Lentivector (Human) (Target 2)

K2574703 1.0 ug DNA
EUR 154

UBE2U sgRNA CRISPR Lentivector (Human) (Target 3)

K2574704 1.0 ug DNA
EUR 154

Ube2u sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3304002 1.0 ug DNA
EUR 154

Ube2u sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3304003 1.0 ug DNA
EUR 154

Ube2u sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3304004 1.0 ug DNA
EUR 154

UBE2U Protein Vector (Human) (pPB-C-His)

PV045009 500 ng
EUR 329

UBE2U Protein Vector (Human) (pPB-N-His)

PV045010 500 ng
EUR 329

UBE2U Protein Vector (Human) (pPM-C-HA)

PV045011 500 ng
EUR 329

UBE2U Protein Vector (Human) (pPM-C-His)

PV045012 500 ng
EUR 329

UBE2U Protein Vector (Mouse) (pPB-C-His)

PV243642 500 ng
EUR 603

UBE2U Protein Vector (Mouse) (pPB-N-His)

PV243643 500 ng
EUR 603

UBE2U Protein Vector (Mouse) (pPM-C-HA)

PV243644 500 ng
EUR 603

UBE2U Protein Vector (Mouse) (pPM-C-His)

PV243645 500 ng
EUR 603

Ube2u 3'UTR GFP Stable Cell Line

TU171477 1.0 ml Ask for price

UBE2U 3'UTR GFP Stable Cell Line

TU077690 1.0 ml
EUR 1394

Ube2u 3'UTR Luciferase Stable Cell Line

TU121477 1.0 ml Ask for price

UBE2U 3'UTR Luciferase Stable Cell Line

TU027690 1.0 ml
EUR 1394

Human Ubiquitin- conjugating enzyme E2 U, UBE2U ELISA KIT

ELI-28354h 96 Tests
EUR 824

UBE2U Rabbit Polyclonal Antibody