UBE2U Rabbit Polyclonal Antibody
UBE2U Polyclonal Antibody |
ABP60824-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2U protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2U from Human. This UBE2U antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2U protein |
UBE2U Polyclonal Antibody |
ABP60824-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2U protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2U from Human. This UBE2U antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2U protein |
UBE2U Polyclonal Antibody |
ABP60824-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2U protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2U from Human. This UBE2U antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2U protein |
UBE2U Rabbit pAb |
A8376-100ul |
Abclonal |
100 ul |
EUR 308 |
UBE2U Rabbit pAb |
A8376-200ul |
Abclonal |
200 ul |
EUR 459 |
UBE2U Rabbit pAb |
A8376-20ul |
Abclonal |
20 ul |
EUR 183 |
UBE2U Rabbit pAb |
A8376-50ul |
Abclonal |
50 ul |
EUR 223 |
UBE2U antibody |
70R-21115 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBE2U antibody |
UBE2U Antibody |
43389-100ul |
SAB |
100ul |
EUR 252 |
UBE2U Antibody |
DF10002 |
Affbiotech |
200ul |
EUR 304 |
Description: UBE2U Antibody detects endogenous levels of total UBE2U. |
UBE2U Antibody |
1-CSB-PA025481GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against UBE2U. Recognizes UBE2U from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
UBE2U Conjugated Antibody |
C43389 |
SAB |
100ul |
EUR 397 |
anti- UBE2U antibody |
FNab09186 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: ubiquitin-conjugating enzyme E2U (putative)
- Uniprot ID: Q5VVX9
- Gene ID: 148581
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against UBE2U |
Anti-UBE2U antibody |
STJ191603 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UBE2U |
UBE2U siRNA |
20-abx938814 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-UBE2U |
YF-PA22429 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to UBE2U |
anti-UBE2U |
YF-PA26912 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to UBE2U |
UBE2U Blocking Peptide |
20-abx161234 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2U Blocking Peptide |
DF10002-BP |
Affbiotech |
1mg |
EUR 195 |
UBE2U cloning plasmid |
CSB-CL716578HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 681
- Sequence: atgcacggcagagcttacctcttgctgcacagagacttctgtgatctcaaggagaacaattataagggtatcactgctaagcctgtaagtgaagatatgatggaatgggaagttgaaattgaaggtctacagaattcagtttggcagggtttagtcttccaactgacaatacattt
- Show more
|
Description: A cloning plasmid for the UBE2U gene. |
Anti-UBE2U (3D4) |
YF-MA19919 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to UBE2U |
Human UBE2U shRNA Plasmid |
20-abx965588 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UBE2U Recombinant Protein (Human) |
RP033757 |
ABM |
100 ug |
Ask for price |
UBE2U Recombinant Protein (Mouse) |
RP182729 |
ABM |
100 ug |
Ask for price |
Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody |
20-abx121234 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody |
20-abx005817 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody |
abx028990-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody |
abx028990-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 U (UBE2U) Antibody |
abx239186-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
UBE2U ORF Vector (Human) (pORF) |
ORF011253 |
ABM |
1.0 ug DNA |
EUR 95 |
Ube2u ORF Vector (Mouse) (pORF) |
ORF060911 |
ABM |
1.0 ug DNA |
EUR 506 |
UBE2U sgRNA CRISPR Lentivector set (Human) |
K2574701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ube2u sgRNA CRISPR Lentivector set (Mouse) |
K3304001 |
ABM |
3 x 1.0 ug |
EUR 339 |
UBE2U sgRNA CRISPR Lentivector (Human) (Target 1) |
K2574702 |
ABM |
1.0 ug DNA |
EUR 154 |
UBE2U sgRNA CRISPR Lentivector (Human) (Target 2) |
K2574703 |
ABM |
1.0 ug DNA |
EUR 154 |
UBE2U sgRNA CRISPR Lentivector (Human) (Target 3) |
K2574704 |
ABM |
1.0 ug DNA |
EUR 154 |
Ube2u sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3304002 |
ABM |
1.0 ug DNA |
EUR 154 |
Ube2u sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3304003 |
ABM |
1.0 ug DNA |
EUR 154 |
Ube2u sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3304004 |
ABM |
1.0 ug DNA |
EUR 154 |
UBE2U Protein Vector (Human) (pPB-C-His) |
PV045009 |
ABM |
500 ng |
EUR 329 |
UBE2U Protein Vector (Human) (pPB-N-His) |
PV045010 |
ABM |
500 ng |
EUR 329 |
UBE2U Protein Vector (Human) (pPM-C-HA) |
PV045011 |
ABM |
500 ng |
EUR 329 |
UBE2U Protein Vector (Human) (pPM-C-His) |
PV045012 |
ABM |
500 ng |
EUR 329 |
UBE2U Protein Vector (Mouse) (pPB-C-His) |
PV243642 |
ABM |
500 ng |
EUR 603 |
UBE2U Protein Vector (Mouse) (pPB-N-His) |
PV243643 |
ABM |
500 ng |
EUR 603 |
UBE2U Protein Vector (Mouse) (pPM-C-HA) |
PV243644 |
ABM |
500 ng |
EUR 603 |
UBE2U Protein Vector (Mouse) (pPM-C-His) |
PV243645 |
ABM |
500 ng |
EUR 603 |
Ube2u 3'UTR GFP Stable Cell Line |
TU171477 |
ABM |
1.0 ml |
Ask for price |
UBE2U 3'UTR GFP Stable Cell Line |
TU077690 |
ABM |
1.0 ml |
EUR 1394 |
Ube2u 3'UTR Luciferase Stable Cell Line |
TU121477 |
ABM |
1.0 ml |
Ask for price |
UBE2U 3'UTR Luciferase Stable Cell Line |
TU027690 |
ABM |
1.0 ml |
EUR 1394 |
Human Ubiquitin- conjugating enzyme E2 U, UBE2U ELISA KIT |
ELI-28354h |
Lifescience Market |
96 Tests |
EUR 824 |
UBE2U Rabbit Polyclonal Antibody