UVRAG Rabbit Polyclonal Antibody

UVRAG Rabbit Polyclonal Antibody

UVRAG Polyclonal Antibody

ABP60866-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
  • Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody

ABP60866-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
  • Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody

31556-100ul 100ul
EUR 252

UVRAG Polyclonal Antibody

31556-50ul 50ul
EUR 187

UVRAG Rabbit pAb

A8462-100ul 100 ul
EUR 308

UVRAG Rabbit pAb

A8462-200ul 200 ul
EUR 459

UVRAG Rabbit pAb

A8462-20ul 20 ul
EUR 183

UVRAG Rabbit pAb

A8462-50ul 50 ul
EUR 223

UVRAG Polyclonal Conjugated Antibody

C31556 100ul
EUR 397

UVRAG antibody

70R-21226 50 ul
EUR 435
Description: Rabbit polyclonal UVRAG antibody

UVRAG Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

UVRAG Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Polyclonal UVRAG Antibody (C-Terminus)

APR03194G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal UVRAG Antibody (C-term L555)

APR04324G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-term L555). This antibody is tested and proven to work in the following applications:

anti- UVRAG antibody

FNab09352 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: UV radiation resistance associated gene
  • Uniprot ID: Q9P2Y5
  • Gene ID: 7405
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against UVRAG

Anti-UVRAG antibody

PAab09352 100 ug
EUR 386

Anti-UVRAG antibody

STJ110760 100 µl
EUR 277
Description: This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer.

Anti-UVRAG antibody

STJ192029 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UVRAG


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA15253 50 ul
EUR 363
Description: Mouse polyclonal to UVRAG


YF-PA15254 50 ug
EUR 363
Description: Mouse polyclonal to UVRAG

UVRAG Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UVRAG Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UVRAG Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human UVRAG

SPC-605D 0.1mg
EUR 354
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG

SPC-605D-A390 0.1mg
EUR 401
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390.

Antibody for Human UVRAG

SPC-605D-A488 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488.

Antibody for Human UVRAG

SPC-605D-A565 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565.

Antibody for Human UVRAG

SPC-605D-A594 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594.

Antibody for Human UVRAG

SPC-605D-A633 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633.

Antibody for Human UVRAG

SPC-605D-A655 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655.

Antibody for Human UVRAG

SPC-605D-A680 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680.

Antibody for Human UVRAG

SPC-605D-A700 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700.

Antibody for Human UVRAG

SPC-605D-ALP 0.1mg
EUR 394
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase.

Antibody for Human UVRAG

SPC-605D-APC 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC .

Antibody for Human UVRAG

SPC-605D-APCCY7 0.1mg
EUR 471
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7.

Antibody for Human UVRAG

SPC-605D-BI 0.1mg
EUR 396
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin.

Antibody for Human UVRAG

SPC-605D-DY350 0.1mg
EUR 414
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350.

Antibody for Human UVRAG

SPC-605D-DY405 0.1mg
EUR 403
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405.

Antibody for Human UVRAG

SPC-605D-DY488 0.1mg
EUR 393
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488.

Antibody for Human UVRAG

SPC-605D-DY594 0.1mg
EUR 395
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594.

Antibody for Human UVRAG

SPC-605D-DY633 0.1mg
EUR 390
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633.

Antibody for Human UVRAG

SPC-605D-FITC 0.1mg
EUR 392
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC.

Antibody for Human UVRAG

SPC-605D-HRP 0.1mg
EUR 388
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP.

Antibody for Human UVRAG

SPC-605D-P594 0.1mg
EUR 407
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594.

Antibody for Human UVRAG

SPC-605D-PCP 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP.

Antibody for Human UVRAG

SPC-605D-RPE 0.1mg
EUR 397
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE .

Antibody for Human UVRAG

SPC-605D-STR 0.1mg
EUR 398
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin.

Antibody for Human UVRAG

SPC-605S 0.012mg
EUR 65
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG

SPC-606D 0.1mg
EUR 354
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG

SPC-606D-A390 0.1mg
EUR 401
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390.

Antibody for Human UVRAG

SPC-606D-A488 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488.

Antibody for Human UVRAG

SPC-606D-A565 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565.

Antibody for Human UVRAG

SPC-606D-A594 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594.

Antibody for Human UVRAG

SPC-606D-A633 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633.

Antibody for Human UVRAG

SPC-606D-A655 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655.

Antibody for Human UVRAG

SPC-606D-A680 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680.

Antibody for Human UVRAG

SPC-606D-A700 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700.

Antibody for Human UVRAG

SPC-606D-ALP 0.1mg
EUR 394
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase.

Antibody for Human UVRAG

SPC-606D-APC 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC .

Antibody for Human UVRAG

SPC-606D-APCCY7 0.1mg
EUR 471
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7.

Antibody for Human UVRAG

SPC-606D-BI 0.1mg
EUR 396
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin.

Antibody for Human UVRAG

SPC-606D-DY350 0.1mg
EUR 414
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350.

Antibody for Human UVRAG

SPC-606D-DY405 0.1mg
EUR 403
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405.

Antibody for Human UVRAG

SPC-606D-DY488 0.1mg
EUR 393
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488.

Antibody for Human UVRAG

SPC-606D-DY594 0.1mg
EUR 395
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594.

Antibody for Human UVRAG

SPC-606D-DY633 0.1mg
EUR 390
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633.

Antibody for Human UVRAG

SPC-606D-FITC 0.1mg
EUR 392
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC.

Antibody for Human UVRAG

SPC-606D-HRP 0.1mg
EUR 388
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP.

Antibody for Human UVRAG

SPC-606D-P594 0.1mg
EUR 407
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594.

Antibody for Human UVRAG

SPC-606D-PCP 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP.

Antibody for Human UVRAG

SPC-606D-RPE 0.1mg
EUR 397
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE .

Antibody for Human UVRAG

SPC-606D-STR 0.1mg
EUR 398
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin.

Antibody for Human UVRAG

SPC-606S 0.012mg
EUR 65
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

UVRAG cloning plasmid

CSB-CL882187HU-10ug 10ug
EUR 698
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2100
  • Sequence: atgagcgcctccgcgtcggtcgggggccaggtcccccagccacccccgggcccggccgctgctctgcctcccggttctgccgcgcgggccctgcatgtggagctgccgtctcagcagcggcgtcttcgacatcttcggaacattgctgcccggaacattgttaatagaaatggcc
  • Show more
Description: A cloning plasmid for the UVRAG gene.

Anti-UVRAG (2E8)

YF-MA16038 100 ug
EUR 363
Description: Mouse monoclonal to UVRAG


EF004158 96 Tests
EUR 689


ELI-28505h 96 Tests
EUR 824

Human UVRAG shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UVRAG Recombinant Protein (Human)

RP034189 100 ug Ask for price

UVRAG Recombinant Protein (Rat)

RP236216 100 ug Ask for price

UVRAG Recombinant Protein (Mouse)

RP183581 100 ug Ask for price

pEGFP-C3-UVRAG Plasmid

PVTB00334-2a 2 ug
EUR 356

Uv Radiation Resistance Associated Gene (UVRAG) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uvrag ORF Vector (Rat) (pORF)

ORF078740 1.0 ug DNA
EUR 506

UVRAG ORF Vector (Human) (pORF)

ORF011397 1.0 ug DNA
EUR 95

Uvrag ORF Vector (Mouse) (pORF)

ORF061195 1.0 ug DNA
EUR 506

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030355-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030355-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030356-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030356-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030357-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030357-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030358-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030358-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx448488-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx448489-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx239352-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

UVRAG sgRNA CRISPR Lentivector set (Human)

K2604001 3 x 1.0 ug
EUR 339

Uvrag sgRNA CRISPR Lentivector set (Mouse)

K4705601 3 x 1.0 ug
EUR 339

Uvrag sgRNA CRISPR Lentivector set (Rat)

K6716701 3 x 1.0 ug
EUR 339

p3*FLAG-Myc-CMV-UVRAG Plasmid

PVTB00364-2a 2 ug
EUR 356

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)

abx446398-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)

abx446399-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)

abx446400-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)

abx446401-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)

abx446402-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)

abx446403-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)

abx446404-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)

abx446405-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)

abx446406-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)

abx446407-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)

abx446410-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)

abx446411-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)

abx446412-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)

abx446413-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)

abx446414-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)

abx446415-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UVRAG sgRNA CRISPR Lentivector (Human) (Target 1)

K2604002 1.0 ug DNA
EUR 154

UVRAG sgRNA CRISPR Lentivector (Human) (Target 2)

K2604003 1.0 ug DNA
EUR 154

UVRAG sgRNA CRISPR Lentivector (Human) (Target 3)

K2604004 1.0 ug DNA
EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4705602 1.0 ug DNA
EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4705603 1.0 ug DNA
EUR 154

UVRAG Rabbit Polyclonal Antibody