Da vinci european bio bank

VDAC3 Rabbit Polyclonal Antibody

VDAC3 Polyclonal Antibody
ABP60884-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VDAC3 protein Applications tips:
Description: A polyclonal antibody for detection of VDAC3 from Human, Mouse, Rat. This VDAC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VDAC3 protein

VDAC3 Polyclonal Antibody
ES10469-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VDAC3 Polyclonal Antibody
ES10469-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VDAC3 Rabbit pAb
A10544-100ul	Abclonal	100 ul	EUR 308

VDAC3 Rabbit pAb
A10544-200ul	Abclonal	200 ul	EUR 459

VDAC3 Rabbit pAb
A10544-20ul	Abclonal	20 ul	EUR 183

VDAC3 Rabbit pAb
A10544-50ul	Abclonal	50 ul	EUR 223

VDAC3 Rabbit pAb
A4183-100ul	Abclonal	100 ul	EUR 308

VDAC3 Rabbit pAb
A4183-200ul	Abclonal	200 ul	EUR 459

VDAC3 Rabbit pAb
A4183-20ul	Abclonal	20 ul	Ask for price

VDAC3 Rabbit pAb
A4183-50ul	Abclonal	50 ul	Ask for price

Polyclonal VDAC3 Antibody (Center)
APR10708G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VDAC3 (Center). This antibody is tested and proven to work in the following applications:

VDAC3 antibody
70R-21249	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal VDAC3 antibody

VDAC3 Antibody
42830-100ul	SAB	100ul	EUR 252

VDAC3 Antibody
DF12499	Affbiotech	200ul	EUR 304
Description: VDAC3 antibody detects endogenous levels of VDAC3.

VDAC3 Antibody
1-CSB-PA162897	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

VDAC3 Antibody
1-CSB-PA025827GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

VDAC3 antibody
70R-5050	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3

VDAC3 antibody
70R-5051	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3

Vdac3/ Rat Vdac3 ELISA Kit
ELI-51180r	Lifescience Market	96 Tests	EUR 886

VDAC3 Conjugated Antibody
C42830	SAB	100ul	EUR 397

anti- VDAC3 antibody
FNab09388	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: voltage-dependent anion channel 3 Uniprot ID: Q9Y277 Gene ID: 7419 Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC3

anti- VDAC3 antibody
FNab09389	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IP: 1:200-1:1000 IHC: 1:20-1:200 Immunogen: voltage-dependent anion channel 3 Uniprot ID: Q9Y277 Gene ID: 7419 Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC3

Anti-VDAC3 antibody
PAab09389	Lifescience Market	100 ug	EUR 386

Anti-VDAC3 antibody
STJ26082	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene.

Anti-VDAC3 antibody
STJ112562	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene.

Anti-VDAC3 antibody
STJ191627	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to VDAC3

VDAC3 siRNA
20-abx906017	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VDAC3 siRNA
20-abx939382	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VDAC3 siRNA
20-abx939383	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VDAC3 Blocking Peptide
33R-4733	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5051

VDAC3 Blocking Peptide
33R-8339	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5050

VDAC3 cloning plasmid
CSB-CL896484HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 852 Sequence: atgtgtaacacaccaacgtactgtgacctaggaaaggctgctaaggatgtcttcaacaaaggatatggctttggcatggtcaagatagacctgaaaaccaagtcttgtagtggagtggaattttctacttctggtcatgcttacactgatacagggaaagcatcaggcaacctaga Show more
Description: A cloning plasmid for the VDAC3 gene.

VDAC3 Blocking Peptide
DF12499-BP	Affbiotech	1mg	EUR 195

Anti-VDAC3 (1C6)
YF-MA16053	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VDAC3

VDAC3 ELISA KIT|Human
EF004187	Lifescience Market	96 Tests	EUR 689

Mouse Vdac3 ELISA KIT
ELI-51389m	Lifescience Market	96 Tests	EUR 865

Bovine VDAC3 ELISA KIT
ELI-44522b	Lifescience Market	96 Tests	EUR 928

Mouse VDAC3 shRNA Plasmid
20-abx973357	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat VDAC3 shRNA Plasmid
20-abx986791	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human VDAC3 shRNA Plasmid
20-abx955076	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human VDAC3 ELISA KIT
ELI-35275h	Lifescience Market	96 Tests	EUR 824

VDAC3 Recombinant Protein (Rat)
RP236342	ABM	100 ug	Ask for price

VDAC3 Recombinant Protein (Human)
RP034300	ABM	100 ug	Ask for price

VDAC3 Recombinant Protein (Mouse)
RP183728	ABM	100 ug	Ask for price

VDAC3 Recombinant Protein (Mouse)
RP183731	ABM	100 ug	Ask for price

Voltage-Dependent Anion Channel 3 (VDAC3) Antibody
20-abx116630	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Vdac3 ORF Vector (Mouse) (pORF)
ORF061244	ABM	1.0 ug DNA	EUR 506

Vdac3 ORF Vector (Mouse) (pORF)
ORF061245	ABM	1.0 ug DNA	EUR 506

Vdac3 ORF Vector (Rat) (pORF)
ORF078782	ABM	1.0 ug DNA	EUR 506

VDAC3 ORF Vector (Human) (pORF)
ORF011434	ABM	1.0 ug DNA	EUR 95

Vdac3 sgRNA CRISPR Lentivector set (Mouse)
K5012201	ABM	3 x 1.0 ug	EUR 339

Vdac3 sgRNA CRISPR Lentivector set (Rat)
K7022001	ABM	3 x 1.0 ug	EUR 339

VDAC3 sgRNA CRISPR Lentivector set (Human)
K2608701	ABM	3 x 1.0 ug	EUR 339

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody
20-abx003093	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Voltage-dependent anion-selective channel protein 3 (VDAC3) Antibody
20-abx214237	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody
20-abx126771	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody
abx029276-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody
abx029276-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody
abx239389-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5012202	ABM	1.0 ug DNA	EUR 154

Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5012203	ABM	1.0 ug DNA	EUR 154

Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5012204	ABM	1.0 ug DNA	EUR 154

Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7022002	ABM	1.0 ug DNA	EUR 154

Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7022003	ABM	1.0 ug DNA	EUR 154

Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7022004	ABM	1.0 ug DNA	EUR 154

VDAC3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2608702	ABM	1.0 ug DNA	EUR 154

VDAC3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2608703	ABM	1.0 ug DNA	EUR 154

VDAC3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2608704	ABM	1.0 ug DNA	EUR 154

VDAC3 Protein Vector (Mouse) (pPB-C-His)
PV244974	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Mouse) (pPB-N-His)
PV244975	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Mouse) (pPM-C-HA)
PV244976	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Mouse) (pPM-C-His)
PV244977	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Mouse) (pPB-C-His)
PV244978	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Mouse) (pPB-N-His)
PV244979	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Mouse) (pPM-C-HA)
PV244980	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Mouse) (pPM-C-His)
PV244981	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Rat) (pPB-C-His)
PV315126	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Rat) (pPB-N-His)
PV315127	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Rat) (pPM-C-HA)
PV315128	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Rat) (pPM-C-His)
PV315129	ABM	500 ng	EUR 603

VDAC3 Protein Vector (Human) (pPB-C-His)
PV045733	ABM	500 ng	EUR 329

VDAC3 Rabbit Polyclonal Antibody