VPS4B Rabbit Polyclonal Antibody
VPS4B Polyclonal Antibody |
ABP60901-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VPS4B protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VPS4B from Human, Mouse. This VPS4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS4B protein |
VPS4B Polyclonal Antibody |
ABP60901-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VPS4B protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VPS4B from Human, Mouse. This VPS4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS4B protein |
VPS4B Polyclonal Antibody |
ABP60901-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VPS4B protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VPS4B from Human, Mouse. This VPS4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS4B protein |
VPS4B Rabbit pAb |
A4315-100ul |
Abclonal |
100 ul |
EUR 308 |
VPS4B Rabbit pAb |
A4315-200ul |
Abclonal |
200 ul |
EUR 459 |
VPS4B Rabbit pAb |
A4315-20ul |
Abclonal |
20 ul |
Ask for price |
VPS4B Rabbit pAb |
A4315-50ul |
Abclonal |
50 ul |
Ask for price |
VPS4B Rabbit pAb |
A15758-100ul |
Abclonal |
100 ul |
EUR 308 |
VPS4B Rabbit pAb |
A15758-200ul |
Abclonal |
200 ul |
EUR 459 |
VPS4B Rabbit pAb |
A15758-20ul |
Abclonal |
20 ul |
EUR 183 |
VPS4B Rabbit pAb |
A15758-50ul |
Abclonal |
50 ul |
EUR 223 |
VPS4B antibody |
70R-21274 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal VPS4B antibody |
VPS4B Antibody |
40402-100ul |
SAB |
100ul |
EUR 252 |
VPS4B Antibody |
47946-100ul |
SAB |
100ul |
EUR 252 |
VPS4B antibody |
70R-10350 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal VPS4B antibody |
VPS4B Antibody |
DF2264 |
Affbiotech |
200ul |
EUR 304 |
Description: VPS4B antibody detects endogenous levels of total VPS4B. |
VPS4B Antibody |
1-CSB-PA808620 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
VPS4B Antibody |
1-CSB-PA025915GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
VPS4B Antibody |
1-CSB-PA025915LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal VPS4B Antibody (C-term) |
AMM08494G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VPS4B (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal VPS4B antibody - N-terminal region |
AMM08495G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VPS4B - N-terminal region. This antibody is tested and proven to work in the following applications: |
VPS4B Conjugated Antibody |
C40402 |
SAB |
100ul |
EUR 397 |
anti- VPS4B antibody |
FNab09446 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000;IP: 1:500-1:5000;IF: 1:10-1:100
- Immunogen: vacuolar protein sorting 4 homolog B(S. cerevisiae)
- Uniprot ID: O75351
- Gene ID: 9525
- Research Area: Metabolism
|
Description: Antibody raised against VPS4B |
Anti-VPS4B antibody |
STJ26099 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. Mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be a yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 18; the gene for the other resides on chromosome 16. |
Anti-VPS4B antibody |
STJ191619 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VPS4B |
VPS4B siRNA |
20-abx939536 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VPS4B siRNA |
20-abx939537 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-VPS4B |
YF-PA25357 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to VPS4B |
VPS4B Antibody, HRP conjugated |
1-CSB-PA025915LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VPS4B Antibody, FITC conjugated |
1-CSB-PA025915LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VPS4B Antibody, Biotin conjugated |
1-CSB-PA025915LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
VPS4B cloning plasmid |
CSB-CL025915HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1335
- Sequence: atgtcatccacttcgcccaacctccagaaagcgatagatctggctagcaaagcagcgcaagaagacaaggctgggaactacgaagaagcccttcagctctatcagcatgctgtgcagtattttcttcatgtcgttaaatatgaagcacagggtgataaagccaagcaaagtatca
- Show more
|
Description: A cloning plasmid for the VPS4B gene. |
VPS4B Blocking Peptide |
20-abx061609 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VPS4B Blocking Peptide |
33R-10320 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VPS4B antibody, catalog no. 70R-10350 |
VPS4B Blocking Peptide |
DF2264-BP |
Affbiotech |
1mg |
EUR 195 |
Human VPS4B shRNA Plasmid |
20-abx956330 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VPS4B protein (His tag) |
80R-3485 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant VPS4B protein (His tag) |
Mouse VPS4B shRNA Plasmid |
20-abx972717 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VPS4B Recombinant Protein (Human) |
RP034426 |
ABM |
100 ug |
Ask for price |
VPS4B Recombinant Protein (Rat) |
RP237053 |
ABM |
100 ug |
Ask for price |
VPS4B Recombinant Protein (Mouse) |
RP184952 |
ABM |
100 ug |
Ask for price |
Vps4b ORF Vector (Rat) (pORF) |
ORF079019 |
ABM |
1.0 ug DNA |
EUR 506 |
VPS4B ORF Vector (Human) (pORF) |
ORF011476 |
ABM |
1.0 ug DNA |
EUR 95 |
Vps4b ORF Vector (Mouse) (pORF) |
ORF061652 |
ABM |
1.0 ug DNA |
EUR 506 |
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody |
20-abx116573 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody |
20-abx003207 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody |
20-abx134910 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody |
abx027624-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody |
abx027624-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Vacuolar protein sorting-associated protein 4B (VPS4B) Antibody |
20-abx339145 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody |
abx239446-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody |
20-abx302379 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VPS4B sgRNA CRISPR Lentivector set (Human) |
K2617201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vps4b sgRNA CRISPR Lentivector set (Mouse) |
K3390301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vps4b sgRNA CRISPR Lentivector set (Rat) |
K7147501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody (HRP) |
20-abx317269 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody (FITC) |
20-abx317270 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody (Biotin) |
20-abx317271 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VPS4B sgRNA CRISPR Lentivector (Human) (Target 1) |
K2617202 |
ABM |
1.0 ug DNA |
EUR 154 |
VPS4B sgRNA CRISPR Lentivector (Human) (Target 2) |
K2617203 |
ABM |
1.0 ug DNA |
EUR 154 |
VPS4B sgRNA CRISPR Lentivector (Human) (Target 3) |
K2617204 |
ABM |
1.0 ug DNA |
EUR 154 |
Vps4b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3390302 |
ABM |
1.0 ug DNA |
EUR 154 |
Vps4b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3390303 |
ABM |
1.0 ug DNA |
EUR 154 |
Vps4b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3390304 |
ABM |
1.0 ug DNA |
EUR 154 |
VPS4B Rabbit Polyclonal Antibody