VPS4B Rabbit Polyclonal Antibody

VPS4B Rabbit Polyclonal Antibody

VPS4B Polyclonal Antibody

ABP60901-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VPS4B protein
  • Applications tips:
Description: A polyclonal antibody for detection of VPS4B from Human, Mouse. This VPS4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS4B protein

VPS4B Polyclonal Antibody

ABP60901-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VPS4B protein
  • Applications tips:
Description: A polyclonal antibody for detection of VPS4B from Human, Mouse. This VPS4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS4B protein

VPS4B Polyclonal Antibody

ABP60901-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VPS4B protein
  • Applications tips:
Description: A polyclonal antibody for detection of VPS4B from Human, Mouse. This VPS4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS4B protein

VPS4B Rabbit pAb

A4315-100ul 100 ul
EUR 308

VPS4B Rabbit pAb

A4315-200ul 200 ul
EUR 459

VPS4B Rabbit pAb

A4315-20ul 20 ul Ask for price

VPS4B Rabbit pAb

A4315-50ul 50 ul Ask for price

VPS4B Rabbit pAb

A15758-100ul 100 ul
EUR 308

VPS4B Rabbit pAb

A15758-200ul 200 ul
EUR 459

VPS4B Rabbit pAb

A15758-20ul 20 ul
EUR 183

VPS4B Rabbit pAb

A15758-50ul 50 ul
EUR 223

VPS4B antibody

70R-21274 50 ul
EUR 435
Description: Rabbit polyclonal VPS4B antibody

VPS4B Antibody

ABD2264 100 ug
EUR 438

VPS4B Antibody

40402-100ul 100ul
EUR 252

VPS4B Antibody

47946-100ul 100ul
EUR 252

VPS4B antibody

70R-10350 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VPS4B antibody

VPS4B Antibody

DF2264 200ul
EUR 304
Description: VPS4B antibody detects endogenous levels of total VPS4B.

VPS4B Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

VPS4B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

VPS4B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal VPS4B Antibody (C-term)

AMM08494G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VPS4B (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal VPS4B antibody - N-terminal region

AMM08495G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VPS4B - N-terminal region. This antibody is tested and proven to work in the following applications:

VPS4B Conjugated Antibody

C40402 100ul
EUR 397

anti- VPS4B antibody

FNab09446 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000;IP: 1:500-1:5000;IF: 1:10-1:100
  • Immunogen: vacuolar protein sorting 4 homolog B(S. cerevisiae)
  • Uniprot ID: O75351
  • Gene ID: 9525
  • Research Area: Metabolism
Description: Antibody raised against VPS4B

Anti-VPS4B antibody

PAab09446 100 ug
EUR 386

Anti-VPS4B antibody

STJ26099 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. Mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be a yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 18; the gene for the other resides on chromosome 16.

Anti-VPS4B antibody

STJ118217 100 µl
EUR 277

Anti-VPS4B antibody

STJ191619 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VPS4B


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25357 50 ul
EUR 334
Description: Mouse polyclonal to VPS4B

VPS4B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VPS4B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VPS4B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VPS4B. Recognizes VPS4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VPS4B cloning plasmid

CSB-CL025915HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1335
  • Sequence: atgtcatccacttcgcccaacctccagaaagcgatagatctggctagcaaagcagcgcaagaagacaaggctgggaactacgaagaagcccttcagctctatcagcatgctgtgcagtattttcttcatgtcgttaaatatgaagcacagggtgataaagccaagcaaagtatca
  • Show more
Description: A cloning plasmid for the VPS4B gene.

VPS4B Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

VPS4B Blocking Peptide

33R-10320 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VPS4B antibody, catalog no. 70R-10350

VPS4B Blocking Peptide

DF2264-BP 1mg
EUR 195


PVT14235 2 ug
EUR 495


EF004226 96 Tests
EUR 689


ELI-44474h 96 Tests
EUR 824

Mouse Vps4b ELISA KIT

ELI-28518m 96 Tests
EUR 865


ELI-51418b 96 Tests
EUR 928

Human VPS4B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VPS4B protein (His tag)

80R-3485 50 ug
EUR 424
Description: Purified recombinant VPS4B protein (His tag)

Mouse VPS4B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VPS4B Recombinant Protein (Human)

RP034426 100 ug Ask for price

VPS4B Recombinant Protein (Rat)

RP237053 100 ug Ask for price

VPS4B Recombinant Protein (Mouse)

RP184952 100 ug Ask for price


PVT14247 2 ug
EUR 599


PVT16808 2 ug
EUR 325

Vps4b ORF Vector (Rat) (pORF)

ORF079019 1.0 ug DNA
EUR 506

VPS4B ORF Vector (Human) (pORF)

ORF011476 1.0 ug DNA
EUR 95

Vps4b ORF Vector (Mouse) (pORF)

ORF061652 1.0 ug DNA
EUR 506

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody

abx027624-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody

abx027624-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Vacuolar protein sorting-associated protein 4B (VPS4B) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody

abx239446-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VPS4B sgRNA CRISPR Lentivector set (Human)

K2617201 3 x 1.0 ug
EUR 339

Vps4b sgRNA CRISPR Lentivector set (Mouse)

K3390301 3 x 1.0 ug
EUR 339

Vps4b sgRNA CRISPR Lentivector set (Rat)

K7147501 3 x 1.0 ug
EUR 339

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 4B (VPS4B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VPS4B sgRNA CRISPR Lentivector (Human) (Target 1)

K2617202 1.0 ug DNA
EUR 154

VPS4B sgRNA CRISPR Lentivector (Human) (Target 2)

K2617203 1.0 ug DNA
EUR 154

VPS4B sgRNA CRISPR Lentivector (Human) (Target 3)

K2617204 1.0 ug DNA
EUR 154

Vps4b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3390302 1.0 ug DNA
EUR 154

Vps4b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3390303 1.0 ug DNA
EUR 154

Vps4b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3390304 1.0 ug DNA
EUR 154

VPS4B Rabbit Polyclonal Antibody