VSX1 Rabbit Polyclonal Antibody

VSX1 Rabbit Polyclonal Antibody

VSX1 Rabbit pAb

A9800-100ul 100 ul
EUR 308

VSX1 Rabbit pAb

A9800-200ul 200 ul
EUR 459

VSX1 Rabbit pAb

A9800-20ul 20 ul
EUR 183

VSX1 Rabbit pAb

A9800-50ul 50 ul
EUR 223

VSX1 Antibody

ABD13315 100 ug
EUR 438

VSX1 Antibody

ABD2476 100 ug
EUR 438

VSX1 Antibody

43597-100ul 100ul
EUR 252

VSX1 Antibody

DF2476 200ul
EUR 304
Description: VSX1 antibody detects endogenous levels of total VSX1.

VSX1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VSX1. Recognizes VSX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Polyclonal Vsx1 Antibody - C-terminal region

APR13993G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vsx1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal Vsx1 antibody - N-terminal region

APR13994G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vsx1 - N-terminal region. This antibody is tested and proven to work in the following applications:

VSX1 Conjugated Antibody

C43597 100ul
EUR 397

anti- VSX1 antibody

FNab09458 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: visual system homeobox 1
  • Uniprot ID: Q9NZR4
  • Gene ID: 30813
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against VSX1

Anti-VSX1 antibody

PAab09458 100 ug
EUR 412

Anti-VSX1 antibody

STJ111842 100 µl
EUR 277
Description: The protein encoded by this gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development. Mutations in this gene can cause posterior polymorphous corneal dystrophy and keratoconus. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-VSX1 antibody

STJ191819 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VSX1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VSX1 cloning plasmid

CSB-CL025938HU-10ug 10ug
EUR 418
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1098
  • Sequence: atgaccggccgggactcgctttccgacgggcgcactagcagcagggcgctggtgcctggcggttcccctaggggctcgcgcccccggggcttcgccatcacggacctgctgggcttggaggccgagctgccggcgcccgctggcccaggacagggatctggctgcgagggtccgg
  • Show more
Description: A cloning plasmid for the VSX1 gene.

VSX1 Blocking Peptide

DF2476-BP 1mg
EUR 195

Rabbit Visual system homeobox 1(VSX1) ELISA kit

E04V0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Visual system homeobox 1(VSX1) ELISA kit

E04V0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Visual system homeobox 1(VSX1) ELISA kit

E04V0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 1(VSX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse VSX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004238 96 Tests
EUR 689

Human VSX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VSX1 Recombinant Protein (Human)

RP044797 100 ug Ask for price

VSX1 Recombinant Protein (Rat)

RP237101 100 ug Ask for price

VSX1 Recombinant Protein (Mouse)

RP185027 100 ug Ask for price

Visual System Homeobox 1 (VSX1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visual System Homeobox 1 (VSX1) Antibody

abx028708-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Visual System Homeobox 1 (VSX1) Antibody

abx028708-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Visual System Homeobox 1 (VSX1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visual System Homeobox 1 (VSX1) Antibody

abx239458-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Vsx1 ORF Vector (Rat) (pORF)

ORF079035 1.0 ug DNA
EUR 506

VSX1 ORF Vector (Human) (pORF)

ORF014933 1.0 ug DNA
EUR 354

Vsx1 ORF Vector (Mouse) (pORF)

ORF061677 1.0 ug DNA
EUR 506

VSX1 sgRNA CRISPR Lentivector set (Human)

K2621801 3 x 1.0 ug
EUR 339

Vsx1 sgRNA CRISPR Lentivector set (Mouse)

K3472601 3 x 1.0 ug
EUR 339

Vsx1 sgRNA CRISPR Lentivector set (Rat)

K6699301 3 x 1.0 ug
EUR 339

VSX1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2621802 1.0 ug DNA
EUR 154

VSX1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2621803 1.0 ug DNA
EUR 154

VSX1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2621804 1.0 ug DNA
EUR 154

Vsx1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3472602 1.0 ug DNA
EUR 154

Vsx1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3472603 1.0 ug DNA
EUR 154

Vsx1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3472604 1.0 ug DNA
EUR 154

Vsx1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6699302 1.0 ug DNA
EUR 154

Vsx1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6699303 1.0 ug DNA
EUR 154

VSX1 Rabbit Polyclonal Antibody