ZNF71 Rabbit Polyclonal Antibody

ZNF71 Rabbit Polyclonal Antibody

ZNF71 Polyclonal Antibody

ES10657-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZNF71 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZNF71 Antibody

44787-100ul 100ul
EUR 252

ZNF71 Antibody

44787-50ul 50ul
EUR 187

ZNF71 Antibody

1-CSB-PA885697LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ZNF71 Antibody

DF2474 200ul
EUR 304
Description: ZNF71 antibody detects endogenous levels of total ZNF71.

ZNF71 antibody

70R-8360 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZNF71 antibody

ZNF71 antibody

70R-8361 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZNF71 antibody

ZNF71 Antibody

ABD2474 100 ug
EUR 438

ZNF71 Polyclonal Antibody, HRP Conjugated

A67855 100 µg
EUR 570.55
Description: Ask the seller for details

ZNF71 Polyclonal Antibody, FITC Conjugated

A67856 100 µg
EUR 570.55
Description: The best epigenetics products

ZNF71 Polyclonal Antibody, Biotin Conjugated

A67857 100 µg
EUR 570.55
Description: kits suitable for this type of research

ZNF71 Conjugated Antibody

C44787 100ul
EUR 397

anti- ZNF71 antibody

FNab09732 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: zinc finger protein 71
  • Uniprot ID: Q9NQZ8
  • Gene ID: 58491
  • Research Area: Metabolism
Description: Antibody raised against ZNF71

Anti-ZNF71 antibody

PAab09732 100 ug
EUR 412

Anti-ZNF71 antibody

STJ191815 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZNF71

ZNF71 siRNA

20-abx941049
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ZNF71

YF-PA20320 50 ul
EUR 363
Description: Mouse polyclonal to ZNF71

anti-ZNF71

YF-PA20321 100 ug
EUR 403
Description: Rabbit polyclonal to ZNF71

ZNF71 Antibody, HRP conjugated

1-CSB-PA885697LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ZNF71 Antibody, FITC conjugated

1-CSB-PA885697LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ZNF71 Antibody, Biotin conjugated

1-CSB-PA885697LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF71. Recognizes ZNF71 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ZNF71 Blocking Peptide

33R-7834 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF71 antibody, catalog no. 70R-8361

ZNF71 Blocking Peptide

33R-6133 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF71 antibody, catalog no. 70R-8360

ZNF71 Blocking Peptide

DF2474-BP 1mg
EUR 195

ZNF71 cloning plasmid

CSB-CL885697HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1470
  • Sequence: atgaaagagttggatccaaagaatgacatttcggaagacaagctctccgttgttggggaggccacggggggacccacgaggaatggtgccaggggtcctggctcagaaggagtgtgggaaccaggcagctggccagagaggccgcggggagatgcaggtgcagagtgggagccat
  • Show more
Description: A cloning plasmid for the ZNF71 gene.

Anti-ZNF71 (3F4)

YF-MA19128 100 ug
EUR 363
Description: Mouse monoclonal to ZNF71

Human ZNF71 ELISA KIT

ELI-14736h 96 Tests
EUR 824

ZNF71 ELISA KIT|Human

EF004504 96 Tests
EUR 689

Human ZNF71 shRNA Plasmid

20-abx961720
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ZNF71 Recombinant Protein (Human)

RP036193 100 ug Ask for price

Zinc Finger Protein 71 (ZNF71) Antibody

abx036448-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zinc Finger Protein 71 (ZNF71) Antibody

20-abx149494
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 71 (ZNF71) Antibody

abx029550-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Zinc Finger Protein 71 (ZNF71) Antibody

abx029550-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Zinc Finger Protein 71 (ZNF71) Antibody

abx239732-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Zinc Finger Protein 71 (ZNF71) Antibody

20-abx311845
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ZNF71 ORF Vector (Human) (pORF)

ORF012065 1.0 ug DNA
EUR 95

Zinc Finger Protein 71 (ZNF71) Antibody (HRP)

20-abx311846
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 71 (ZNF71) Antibody (FITC)

20-abx311847
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 71 (ZNF71) Antibody (Biotin)

20-abx311848
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EZFIT/ZNF71 (anti EZFIT antibody, clone# K9716)

PP-K9716-00 0.1mg/100uL
EUR 623
Description: The EZFIT/ZNF71 (anti EZFIT antibody, clone# K9716) is available in Europe and for worldwide shipping via Gentaur.

ZNF71 sgRNA CRISPR Lentivector set (Human)

K2684401 3 x 1.0 ug
EUR 339

ZNF71 sgRNA CRISPR Lentivector (Human) (Target 1)

K2684402 1.0 ug DNA
EUR 154

ZNF71 sgRNA CRISPR Lentivector (Human) (Target 2)

K2684403 1.0 ug DNA
EUR 154

ZNF71 Rabbit Polyclonal Antibody